|
Status |
Public on Nov 13, 2020 |
Title |
HL60_myb 4C |
Sample type |
SRA |
|
|
Source name |
acute promyelocytic leukemia cells
|
Organism |
Homo sapiens |
Characteristics |
tissue: peripheral blood tumor: acute promyelocytic leukemia treatment: normal culture
|
Extracted molecule |
genomic DNA |
Extraction protocol |
10×106 cells were cross-linked by 2% formaldehyde for 10 min and 0.125 M glycine was added to prevent further cross-linking. Cells were collected and washed with 14 ml PBS twice, then cells were centrifuged and suspended in lysis buffer to disrupt membranes and isolate chromatin. A primary 6-base cutter, 400 U HindⅢ was used for the first digestion at 37°C with shaking overnight followed by diluted ligations. After precipitation, chromatin was further subjected to a second round of digestions with a 4-base cutter Dpn Ⅱ and ligation. Primers for the c-myb viewpoint (forward, AGTATTAATTTGCC-TTGTCC; reverse, GCTAATGTTGGATATATTGC) were designed. Inverse polymerase chain reaction (PCR) was carried out to amplify sample libraries. Libraries were pooled and sequenced using the Illumina HiSeq machine as 150-bp paire-end sequencing reads.
|
|
|
Library strategy |
OTHER |
Library source |
genomic |
Library selection |
other |
Instrument model |
HiSeq X Ten |
|
|
Data processing |
Illumina Casava1.8 software used for basecalling. 4C-Seq reads were trimmed for adaptor sequence and are mapped to a reduced genome consisting of unique sequence fragments adjacent to the primary restriction enzyme sites in the genome using bowtie2 with parameters -p 4 -N 0 -5 34 -3 80 Removing the self-ligated and undigested fragments Analyzing 4C interactions using 4C-ker Genome_build: hg19 Supplementary_files_format_and_content: BedGraph files include normalized counts for long-range interactions by 4C-ker
|
|
|
Submission date |
Nov 13, 2019 |
Last update date |
Nov 14, 2020 |
Contact name |
Mengjia Li |
E-mail(s) |
mengjia.li@outlook.com
|
Organization name |
Shanghai Ocean University
|
Department |
College of Fisheries and Life Science
|
Lab |
Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources
|
Street address |
999 Hucheng Ring Road
|
City |
Shanghai |
ZIP/Postal code |
201306 |
Country |
China |
|
|
Platform ID |
GPL20795 |
Series (1) |
GSE140321 |
Distal regulation of c-myb expression in human myeloid leukemia cells |
|
Relations |
BioSample |
SAMN13279744 |
SRA |
SRX7135330 |