NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM4159252 Query DataSets for GSM4159252
Status Public on Nov 13, 2020
Title HL60_myb 4C
Sample type SRA
 
Source name acute promyelocytic leukemia cells
Organism Homo sapiens
Characteristics tissue: peripheral blood
tumor: acute promyelocytic leukemia
treatment: normal culture
Extracted molecule genomic DNA
Extraction protocol 10×106 cells were cross-linked by 2% formaldehyde for 10 min and 0.125 M glycine was added to prevent further cross-linking. Cells were collected and washed with 14 ml PBS twice, then cells were centrifuged and suspended in lysis buffer to disrupt membranes and isolate chromatin. A primary 6-base cutter, 400 U HindⅢ was used for the first digestion at 37°C with shaking overnight followed by diluted ligations. After precipitation, chromatin was further subjected to a second round of digestions with a 4-base cutter Dpn Ⅱ and ligation. Primers for the c-myb viewpoint (forward, AGTATTAATTTGCC-TTGTCC; reverse, GCTAATGTTGGATATATTGC) were designed. Inverse polymerase chain reaction (PCR) was carried out to amplify sample libraries.
Libraries were pooled and sequenced using the Illumina HiSeq machine as 150-bp paire-end sequencing reads.
 
Library strategy OTHER
Library source genomic
Library selection other
Instrument model HiSeq X Ten
 
Data processing Illumina Casava1.8 software used for basecalling.
4C-Seq reads were trimmed for adaptor sequence and are mapped to a reduced genome consisting of unique sequence fragments adjacent to the primary restriction enzyme sites in the genome using bowtie2 with parameters -p 4 -N 0 -5 34 -3 80
Removing the self-ligated and undigested fragments
Analyzing 4C interactions using 4C-ker
Genome_build: hg19
Supplementary_files_format_and_content: BedGraph files include normalized counts for long-range interactions by 4C-ker
 
Submission date Nov 13, 2019
Last update date Nov 14, 2020
Contact name Mengjia Li
E-mail(s) mengjia.li@outlook.com
Organization name Shanghai Ocean University
Department College of Fisheries and Life Science
Lab Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources
Street address 999 Hucheng Ring Road
City Shanghai
ZIP/Postal code 201306
Country China
 
Platform ID GPL20795
Series (1)
GSE140321 Distal regulation of c-myb expression in human myeloid leukemia cells
Relations
BioSample SAMN13279744
SRA SRX7135330

Supplementary file Size Download File type/resource
GSM4159252_HL60_norm_counts.bedGraph.gz 547.5 Kb (ftp)(http) BEDGRAPH
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap