|
| Status |
Public on Oct 20, 2020 |
| Title |
RNA_ASFV_6H_1 |
| Sample type |
SRA |
| |
|
| Source name |
porcine alveolar macrophages
|
| Organism |
Sus scrofa |
| Characteristics |
cell type: porcine alveolar macrophages
breed: SPF
age: 4-week-old
infection: ASFV infection
time point (hour post infection): 6 h
|
| Treatment protocol |
Cells were infected with ASFV Chinese isolates (Pig/HLJ/18) at a multiplicity of infection (MOI) of 1 and incubated for 1 h at 37°C. The infected cells were then cultured at 37°C with fresh RPMI 1640 medium supplemented with 10% FBS.
|
| Growth protocol |
Porcine alveolar macrophages (PAMs) were collected from 4-week-old SPF pigs as previously described. PAMs were maintained in RPMI1640 medium supplemented with 10% FBS at 37°C with 5% CO2.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
The RNA was extracted from the infected cells at 0-, 6-, 12- and 24-hpi.
For strand specific RNA-seq, depletion of ribosomal RNA (rRNA) and RNA-seq libraries were constructed according to the manufacturer’s protocol of the Illumina kit. For small RNA-seq, small RNA-seq libraries were constructed according to the manufacturer’s protocol of the Illumina kit.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
HiSeq X Ten |
| |
|
| Description |
6 h post ASFV infection
mRNA_expression_profile.txt
|
| Data processing |
Basecalls performed using CASAVA
For RNA-seq, Illumina sequencing reads were mapped to pig (Sus scrofa v11.1) and ASFV (MK333180.1) genome by using Hisat2.1.0 with default settings for parameters. Kallisto_0.45.1 was used for quantifying abundance of each transcript. TPM values were calculated to measure the expression levels of gene’s transcripts. Differential expression analysis of genes was performed by Sleuth_0.30.0. Differentially expressed genes were filtered by the following parameters: TPM ≧ 20, fold-changed (FC) ≧ 2 and p-value < 0.05.
For small RNA-seq, sequencing adapters (AGATCGGAAGAGCACACGTCT) was removed by using cutadpt1.18. Reads were mapped to pig genome by using Bowtie2.2.5. The unmapped reads were collected and then mapped to ASFV genome. A brief annotation of PAMs encoded small RNAs were performed by using unitas_1.7.0. FeatureCount_1.6.4 was used for quantifying abundance of each miRNA. RPM values were calculated to measure the expression levels of each miRNA. Differential expression analysis of miRNAs was performed by DESeq2_1.22.2. Differentially expressed miRNAs were filtered by the following parameters: fold-changed (FC) ≧ 2 and p-value < 0.05.
Genome_build: Sus_scrofa_v11.1
Supplementary_files_format_and_content: Tab-delimited text file includes TPM values for each RNA-seq samples. Tab-delimited text file includes reads_count for each small RNA-seq samples.
|
| |
|
| Submission date |
Feb 26, 2020 |
| Last update date |
Oct 20, 2020 |
| Contact name |
Jingrui Li |
| E-mail(s) |
jrli@cau.edu.cn
|
| Organization name |
China Agricultural Universtiy
|
| Street address |
Yuanmingyuan West Road No.2
|
| City |
Beijing |
| ZIP/Postal code |
100193 |
| Country |
China |
| |
|
| Platform ID |
GPL22918 |
| Series (1) |
| GSE145954 |
Whole Transcriptome analysis for porcine alveolar macrophage infected by African Swine Fever Virus |
|
| Relations |
| BioSample |
SAMN14211881 |
| SRA |
SRX7805544 |
