 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 22, 2020 |
| Title |
TOD_MapSeq |
| Sample type |
SRA |
| |
|
| Source name |
in vitro transcribed
|
| Organism |
synthetic construct |
| Characteristics |
sample type: in vitro transcribed
library type: pooled
adapter strategy: direct ligation
rna modification: Methylation or 2'-hydroxyl acylation
|
| Treatment protocol |
1.2 pmol of RNA was denatured in 50 mM Na-HEPES pH 8.0 at 90 ℃ for 3 minutes and cooled at room temperature for 10 minutes. The RNA was then folded with the addition of MgCl2 to a final concentration of 10 mM in 15 μL and incubated at 50 ℃ for 30 minutes, then left at room temperature for 10 minutes. For chemical modification of folded RNA, fresh working stocks of dimethyl sulfate (DMS, Sigma-Aldrich) and 1-methyl-7-nitroisatoic anhydride (1M7) were prepared. For DMS, 1 μL of DMS was mixed with 99 μL of 100% EtOH. The 100 μL solution was then added to 100 μL RNase free H2O for a final volume of 200 μL. For 1M7, 4.24 mg of 1M7 was dissolved in 1 mL of anhydrous DMSO. In the modification step, 5 μL of modifying agent (either DMS or 1M7) working stock was added to 15 μL of folded RNA and incubated at room temperature for 15 minutes. Modification reactions were quenched with 5 μL of quenching solution (β-mercaptoethanol or 0.5 M Na-MES pH 6.0 for DMS and 1M7, respectively).
|
| Growth protocol |
RNA was transcribed using DNA templates containing a T7 RNA Polymerase promoter sequence at their 5´ ends and a 20 base-pair Tail2 sequence at their 3´ ends (Supplemental File, sequences.xlsx). The RNA sequence consisted of the sequence of interest flanked by a reference hairpin on each side serving as internal structural controls. The DNA template was assembled through DNA primer assembly using primers designed using the Primerize tool (https://primerize.stanford.edu/). Designed primers were ordered in plate format from Integrated DNA Technologies (IDT) and assembled via PCR assembly with Phusion DNA polymerase as described on the Primerize PCR Assembly Protocol (https://primerize.stanford.edu/protocol/#PCR). Assembly products were verified for size via agarose gel electrophoresis and subsequently purified using Agencourt RNAClean XP beads. Purified DNA was quantified via NanoDrop (Thermo Scientific) and 8 pmol of purified DNA was then used for in vitro transcription with T7 RNA polymerase (New England Biolabs Inc.).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Enzymatically synthesized RNA was purified with Agencourt RNAClean XP beads.
Reverse transcription and ligation of the second Illumina sequencing adapter was carried out as previously described (Cheng et al. 2015, eLife). Briefly, reverse transcription was carried out with primers containing an RTB barcode and Illumina . The RTB barcode assigned to each sample and the sequence of each RTB barcoded reverse transcription primer are listed in Supplemental File sequences.xlsx. For the second adapter ligation, P_TruSeqAdapt01_p and P_TruSeqAdapt02_p ligation primers were used for TOD-S1 and TOD-S7 constructs, respectively (see Supplemental File sequences.xlsx). Sequencing libraries were quantified by qPCR and sequenced on an Illumina MiSeq using a 150-cycle v3 chemistry kit per manufacturer’s instructions, with 35 and 121 cycles used for read 1 and read 2, respectively.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina MiSeq |
| |
|
| Data processing |
Raw sequencing files were demultiplexed using novobarcode.
For M2-seq analysis of the HIV 3' UTR construct, the demultiplexed files were run through the ShapeMapper software, and the resulting mutational profile strings were run through the M2-seq analysis pipeline (further details can be found at: https://github.com/ribokit/m2seq) to yield the final two-dimensional reactivity files.
For polyA length analysis, raw demultiplexed reads were analyzed with custom python scripts that directly searched for polyAs surrounded by constant flanking regions. For more information see: https://github.com/DasLab/Anomalous_polyA_RT.
For reactivity analysis, the demultiplexed reads were analyzed with the RNAFramework, ShapeMapper, and ShapeMapper2 pipelines. Custon python scripts were then used to compare computed reactivities between packages.
For more information see: https://github.com/DasLab/Anomalous_polyA_RT.
genome build:
S1:GGAAAAGGCGTCGAGTAGACGCCAACAACGGAAACCTGAAAGATCAAAAAAAAAAAGATCAAGTACAAAAAAAAAAAGTACAACAGGAAAAAAAAAAAGCATAGGTTCGCCTATGCAAACCAAACCGTCAGCGAGTAGCTGACAAAAAGAAACAACAAC,
S7:GGAAAAGGCGTCGAGTAGACGCCAACAACGGAAACCTGAAAGATCAAAAAACAAAAGATCAAGTACAAAAAACAAAAGTACAACAGGAAAAAACAAAAGCATAGGTTCGCCTATGCAAACCAAACCGTCAGCGAGTAGCTGACAAAAAGAAACAACAACAACAAC
Supplementary_files_format_and_content:
For HIV 3'UTR M2-seq analysis: mutation strings indicating the location of mutations for each read are provided in the format of one read per line in a one-hot encoding. Two-dimensional reactivity files are provided in the RDAT file format as specified here: https://rmdb.stanford.edu/deposit/specs/.
For polyA length analysis, CSV tables are provided for each construct, with each column representing data relevant to a single condition (e.g. reverse transcribed with TGIRT). Values in each cell represent the raw number of reads corresponding to a given polyA length. For insertion/substitution tables, the frequency of an insertion or substitution at each nucleotide along the polyA tail (read in 3' to 5' direction).
For reactivity analysis, each plain text file contains the reactivity of a construct for a given condition. Each line contains a reactivity score of a single nucleotide position.
|
| |
|
| Submission date |
Apr 21, 2020 |
| Last update date |
Apr 23, 2020 |
| Contact name |
Rhiju Das |
| E-mail(s) |
rhiju@stanford.edu
|
| Organization name |
Stanford University School of Medicin
|
| Department |
Biochemistry
|
| Lab |
Das
|
| Street address |
279 Campus Dr, B419 Beckman Center
|
| City |
Stanford |
| State/province |
California |
| ZIP/Postal code |
94305 |
| Country |
USA |
| |
|
| Platform ID |
GPL17769 |
| Series (1) |
| GSE149061 |
Anomalous reverse transcription through chemical modifications in polyadenosine stretches |
|
| Relations |
| BioSample |
SAMN14655871 |
| SRA |
SRX8151468 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM4489498_TOD_MapSeq_processed.tar.gz |
43.6 Kb |
(ftp)(http) |
TAR |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
