spe-9 (hc88) mutant animals were cultured at 23dC on regular NGM/OP50 plates after synchronized their growth at the early L1 stage. RNAs were purified at Day 0, 5, 8 and 12 post-L4 molt.
Extracted molecule
total RNA
Extraction protocol
RNAs enriched for small RNA species (less than 200nt) were prepared using the mirVana miRNA Isolation kit (Ambion) with small RNA enrichment procedure. cDNA libraries for small RNAs were made from 10 µg of RNA using the DGE-Small RNA Sample Prep Kit (Illumina) according to the manufacturer’s instructions (As for two biological replicas, named Sample5_spe-9_DAY0_Rep and Sample6_spe-9_DAY8_Rep, 10 µg of total RNAs were used as starting materials).
Library strategy
RNA-Seq
Library source
transcriptomic
Library selection
size fractionation
Instrument model
Illumina Genome Analyzer II
Description
none
Data processing
The raw data were aligned to the C. elegans genome (genome build WormBase WS190) using the SOAP program (ver. 1.10 Li, R. et al., Bioinformatics 24: 713-714. 2008) with the following command options: -w 5 -S 3 -A TCGTATGCCGTCTTCTGCTTGT (maximum 2 base pair mismatches were allowed as a default option). Then, the number of times of each read sequenced was examined.
