GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM4661077

Query DataSets for GSM4661077

Status

Public on Jul 08, 2020

Title

RNAseq_6hr_Rep2

Sample type

SRA

Source name

maize seedling roots

Organism

Zea mays

Characteristics

tissue: seedling roots
treatment: 6 hour tunicamycin treatment
cultivar: B73

Treatment protocol

7-day old seedlings were treated with 5ug/ml tunicamycin in DMSO for 0, 6 and 12 hours

Growth protocol

sterile maize B73 seeds were placed in sterile Sigma bottles (Cat No V8630-E100) with two layers of wet filter paper. The seeds were incubated at 30°C for two days then transferred to an illuminated incubator at 23°C for 7 days.

Extracted molecule

total RNA

Extraction protocol

Total RNA was extracted from 300 uL aliquoted clarified lysate using a Trizol extraction method until the phase separation step and was followed by adding an equal volume of ice cold 100% ethanol to the aqueous phase and further purification using Zymo RNA clean & concentrator -5 columns (Zymo R1016) according to manufacturer’s protocol and quantified using a Nanodrop spectrophotometer. Integrity of total RNA was assessed by electrophoresis followed by DNase treatment and integrity assessment of DNase-treated total RNA for riboseq samples. rRNA depletion was carried out using half reactions of Ribo-Zero for plant seed/root kit (Illumina MRZSR116) per ~5 ug of DNAse-treated total RNA sample followed by RNA clean up using Zymo RNA clean & concentrator -5 columns (Zymo R1016) according to the Illumina TruSeq Ribo Profile kit protocol (Illumina 15066016). Total RNA was subjected to random fragmentation by alkaline hydrolysis as follows: 10 uL total RNA (~1 ug) mixed with 10 uL 2x fragmentation buffer (2 mM EDTA (pH 8), 12 mM Na2CO3, 88 mM NaHCO3), incubated at 95 ˚C in a thermocycler for 20 min. The reaction was terminated by addition of 280 uL stop solution (0.3 M NaOAc, 53.6 ug/mL Glyco Blue) and 750 uL ice cold 100% ethanol followed by precipitation at -80˚C for 3 hr. RNA was precipitated by centrifugation at 21k g for 45 minutes at 4˚C and washed with ice cold 80% ethanol and resuspended in water. For size-selections, denatured rRNA-depleted fragmented RNA was subjected to electrophoresis on a 15% TBE-Urea gel (Invitrogen EC6885BOX) at 120V for 5 min and 170V for 85 min, stained in the gel with SYBR gold (Invitrogen S11494), and visualized on a blue light transilluminator. The gel region between 28 nt and 34 nt RNA size markers was excised and transferred to a 0.5 ml tube with a hole at the bottom made by a 18 G syringe needle, and the tube was placed a 2 mL microfuge tube. The tube was then centrifuged at 21k g for 2 min at 4˚ C to crush the gel slice and transfer its contents to the 2 mL microfuge tube. 500 uL RNA gel extraction buffer (0.3 M NaOAc (pH5.5), 1 mM EDTA (pH 8), 10 mM Tris-HCl (pH 7.5), 0.25% (w/v) SDS) was added and incubated overnight at 4 ˚C on a shaker. Eluted RNA were filtered through 0.22 µ SpinX cellulose acetate filter columns (Sigma-Aldrich CL8161). 2 uL Glyco Blue (Ambion AM9516) and equal volume of ice cold 100% isopropanol were added to the supernatant, and RNA were precipitated at -80 ˚C for 3 hours followed by centrifugation for 45 min at 21k g at 4 ˚C, washing with ice cold 80% ethanol and resuspending the pellet in 3.5 uL water.
250 mg of 10-day old maize B73 seedling roots (in biological duplicates) were ground with liquid N2 in 2.5 mL of polysome extraction buffer (PEB; 50 mM Tris-Acetate (pH 8), 200 mM KCl, 15 mM MgCl2, 1% (v/v) Triton X-100, 2% (v/v) polyoxyethelene 10-tridecylether, 200 mM sucrose, 100 g/mL cycloheximide, 100 g/mL chloramphenicol, 20 mM -mercaptoethanol). The crude lysate was filtered through a 40 µm cell strainer (Falcon 08-771-1) by centrifugation at 4000 g for 2 minutes. The flow through supernatant was further clarified by centrifugation at 21k g for 15 min. 300 l of clarified lysate were aliquoted for total RNA extraction. Subsequent steps for ribosome profiling and RNAseq are described above in SAMPLES section
cDNA libraries were prepared using Nextflex small RNA-Seq kit v3 (Bioo Scientific 5132-05) according to manufacturer’s protocol and 12 cycles of PCR. Quality of the libraries was assessed using an Agilent bioanalyzer high sensitivity DNA Assay kit. Libraries were quantified using Qubit dsDNA HS Assay kit (Invitrogen Q32854) and diluted to same concentration. The riboseq and RNAseq libraries were pooled together for multiplexing and sequenced in two lanes using an Illumina HiSeq 3000 to yield single-end 50 bp reads. Because of low depth of riboseq sequences, riboseq samples were pooled and resequenced in additional two lanes using Illumina HiSeq 3000 to yield single-end 50 bp reads.
Ribo-seq and RNA-seq

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina HiSeq 3000

Description

RNA-seq data

Data processing

de-multiplexed sequenced data (fastq) files were obtained from the DNA facility at Iowa State University. The quality of raw sequencing reads was assessed using FastQC. Cutadapt 1.16 was used to remove adapters from raw sequencing reads using the following parameters: “ -a TGGAATTCTCGGGTGCCAAGG --discard-untrimmed --minimum-length 23.” Adapter trimmed reads were further processed to trim the four random bases, that were added to both ends of riboseq and RNAseq reads during library preparation, using cutadapt 1.16 with the following parameters: “-u 4 -u -4”. Subsequently, riboseq reads that were 27 nt to 32 nt in length and RNAseq reads from 25 nt to 40 nt were retained, and the rest were filtered out.
Subsequently, noncoding RNA (rRNA, snoRNA and tRNA) was depleted by mapping the reads to the maize ncRNA reference file (ftp://ftp.gramene.org/pub/gramene/CURRENT_RELEASE/fasta/zea_mays/ncrna/) using bowtie 1.2 with the following parameters: “-n 0 -l 23” and retaining only the unmapped reads. ncRNA depleted reads were subsequently mapped to maize cDNA and CDS reference transcriptomes (ftp://ftp.gramene.org/pub/gramene/CURRENT_RELEASE/fasta/zea_mays) using bowtie 1.2 with following parameters: “-l 23 -v 2 -m 20 --best -k 1” and only aligned reads were retained. cDNA and CDS aligned files were converted from sam to bam, sorted, indexed and read counts were extracted from CDS-aligned files using samtools view, sort, index and idxstats tools respectively. All transcriptome-level read counts were consolidated as gene-level read counts.
For gene-expression analysis, CDS-aligned read count table was used that is attached as the PROCESSED DATA FILES.
Genome_build: Zea_mays.AGPv4.ncrna.fa.gz
Genome_build: Zea_mays.AGPv4.cdna.all.fa.gz
Genome_build: Zea_mays.AGPv4.cds.all.fa.gz
Supplementary_files_format_and_content: excel sheet (.xlsx) consisting of raw count data of CDS-aligned riboseq and RNAseq reads

Submission date

Jul 07, 2020

Last update date

Jul 08, 2020

Contact name

Wyatt Allen Miller

E-mail(s)

wamiller@iastate.edu

Phone

5152942436

Organization name

Iowa State University