GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM4794787

Query DataSets for GSM4794787

Status

Public on Dec 01, 2020

Title

Ash1-V5_Input

Sample type

SRA

Source name

log phase yeast cells

Organism

Saccharomyces cerevisiae

Characteristics

strain: DY18407 - MATa ASH1-V5::HIS3MX
strain background: W303 leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15
chip antibody: None

Treatment protocol

Not applicable

Growth protocol

Yeast cells were grown at 30°C in YPA medium (1% yeast extract, 2% bactopeptone, 0.002% adenine) supplemented with 2% dextrose to an OD660 of 0.7 to 0.9. Cells were cross-linked in 1% formaldehyde for 20 minutes at 25°C (Ash1-V5) or overnight at 4°C (Tup1-V5, Rpd3-V5) and quenched with the addition of 2.5M glycine to a final concentration of 125mM. Cells were harvested by centrifugation and washed twice in Tris-buffered saline and stored at -80°C.

Extracted molecule

genomic DNA

Extraction protocol

Cells were resuspended in Lysis Buffer (0.1% deoxycholic acid, 1 mM EDTA, 50 mM HEPES pH 7.5, 140 mM NaCl, 1% Triton X-100, protease inhibitors) and lysed with ten 2-min rounds of bead beating with zirconia beads. Lysed cells were collected by centrifugation, washed once with Lysis Buffer and sonicated in fresh Lysis Buffer for 9 rounds of 30 seconds each with a Misonix sonicator, power level 3.5. Sonicated material was centrifuged, and supernatants were used for chromatin immunoprecipitations. Anti-mouse magnetic Dyna beads (Invitrogen) were prepared for immunoprecipitation by blocking with 1 mg/mL BSA overnight, followed by several hours of incubation with mouse anti-V5 antibody (Abcam). Normalized chromatin amounts were added to prepared Dyna beads and incubated overnight at 4°C with rotation. Beads were washed twice with Lysis Buffer, twice with Lysis Buffer supplemented up to 500 mM NaCl, twice with LiCl Wash Buffer (0.5% deoxycholic acid, 1 mM EDTA, 250 mM LiCl, 0.5% NP-40, 10 mM Tris pH 8.0) and once with TE. Protein-DNA complexes were eluted from the beads with Elution Buffer (50 mM Tris pH 8.0, 1% SDS, 10 mM EDTA) and incubated at 65°C overnight to reverse cross-links. Multiple identical ChIPs from each cell sample replicate were combined and purified using the MinElute PCR purification kit (QIAGEN), per manufacturer’s instructions.
NEB Next ChIP-Seq with dual index primers

Library strategy

ChIP-Seq

Library source

genomic

Library selection

ChIP

Instrument model

Illumina NovaSeq 6000

Data processing

Fastq files were aligned to sacCer3 using Novocraft Novoalign (v3.8.2) with options to trim Illumina adapters (AGATCGGAAGAGCACACGTCTGAACTCCAGTCA and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT) and allow for one random multi-alignment. Files were converted to Bam format with samtools (v1.5).
Replicate ChIP and corresponding Input Bam files were processed with Multi-Replicate Macs2 ChIPSeq Pipeline (version 8, https://github.com/HuntsmanCancerInstitute/MultiRepMacsChIPSeq), with options to sub-sample replicate fragments to 20%, exclude chrM and 2-micron chromosome, exclude custom high-copy intervals (telomeres and rDNA), depth-normalize to 1 million reads and average replicates, and call peaks using Macs2 (v. 2.1.0) with q-value cutoff of 2, peak size of 200 bp, peak gap of 100 bp, and depth normalized to 5 million reads. Normalized paired-end fragment coverage files were saved as bigWig files.
Genome_build: sacCer3
Supplementary_files_format_and_content: Paired-end fragment coverage files in bigWig format after duplicate sub-sampling, high-copy region exclusion, replicate averaging, and depth normalization to 1 million reads.

Submission date

Sep 17, 2020

Last update date

Dec 01, 2020

Contact name

David J Stillman

E-mail(s)

david.stillman@path.utah.edu

Organization name

University of Utah

Department

Pathology