|
| Status |
Public on May 04, 2021 |
| Title |
E10.5_MS155_14 |
| Sample type |
SRA |
| |
|
| Source name |
Mouse female genital ridge E10.5
|
| Organism |
Mus musculus |
| Characteristics |
tissue: genital ridge
developmental stage: E10.5
cell type: mST
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA preparation, cDNA synthesis and amplification from single cells were perfomed essentially as reported in [Nakamura et al., Nucleic Acids Res. 2015 43(9):e60]. Library constructions for Illumina System were performed as reported in [Ishikura et.al., Cell Rep. 2016 17(10):3789-2804].
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
Single cell transcriptome of amplified cDNA from mouse embryo at E10.5
|
| Data processing |
All the reads were surveyed and the adaptor or the poly-A sequences were trimmed by cutadapt-1.3 with options "-e 0.1 -q 20 -n 2 -O 1 -m 30 -a CTCGAGGGCGCGCCGGATCC -g CTCGAGGGCGCGCCGGATCC -a AAAAAAAAAAAAAAAAAAAA -a TTTTTTTTTTTTTTTTTTTT". The trimmed reads with less than 30 bp were discarded.
Untrimmed and trimmed reads of 30 bp or longer were mapped onto the mouse genome, mm10, or cynomolgus monkey genome, macFas5.0, and the ERCC spike-in RNA sequences with tophat-1.4.1/bowtie1.0.1 with the “—no-coverage-search” option.
Mapped reads on the genome and the ERCC were separated, and the reads on the genome were converted into the expression levels (RPM) by cufflinks-2.2.0 using the “—compatible-hits-norm”, “—max-mle-iterations 50000", “—no-length-correction” and “—library-type fr-secondstrand” options and GRC38.p2 reference gene annotations with extended TTSs. For the reference gene annotations used in cufflinks, we extended the TTSs of the reference genes up to 10 kb downstream to correctly estimate the expression levels of genes whose transcripts are longer than the reference toward the 3 prime.
Expression levels (read counts per gene) were also estimated with HTSeq v0.9.1.
Genome_build: mm10
Genome_build: macFas5.0
Supplementary_files_format_and_content: tab-delimited text files include RPM values for each Sample
Supplementary_files_format_and_content: tab-delimited text files include gene name, entrez_id and read count for each Sample
|
| |
|
| Submission date |
Oct 25, 2020 |
| Last update date |
May 05, 2021 |
| Contact name |
Yukihiro Yabuta |
| E-mail(s) |
yabyab@anat2.med.kyoto-u.ac.jp
|
| Organization name |
Kyoto University, Graduate school of medicine
|
| Department |
Anatomy and Cell Biology
|
| Street address |
Yoshida-Konoe-cho, Sakyo-ku
|
| City |
Kyoto |
| State/province |
Kyoto |
| ZIP/Postal code |
606-8501 |
| Country |
Japan |
| |
|
| Platform ID |
GPL19057 |
| Series (2) |
| GSE160049 |
The embryonic ontogeny of the gonadal somatic cells in mice and monkeys [sc3seq] |
| GSE160050 |
The embryonic ontogeny of the gonadal somatic cells in mice and monkeys |
|
| Relations |
| BioSample |
SAMN16543269 |
| SRA |
SRX9357378 |
