 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jul 01, 2021 |
| Title |
WT_tapetum_sRNA-seq_rep1 |
| Sample type |
SRA |
| |
|
| Source name |
Flower bud
|
| Organism |
Arabidopsis thaliana |
| Characteristics |
tissue: Anther
cell type: Tapetum
genotype: WT
|
| Treatment protocol |
No special treatment to all of the biological materials
|
| Growth protocol |
Arabidopsis plants were grown under 16h light/8h dark in a growth chamber (21°C, 70% humidity)
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Meiocyte or tapetum cells was isolated using the same method as for BS-seq.Total RNA was then extracted from isolated pure meiocyte or tapetum cells using Direct-zol RNA Kit (Zymo, #R2061).
sRNA library was constructed using the RealSeq-Biofluids NGS Library Preparation Kit (Biocat,600-00048-SOM).To further enrich the small RNA fractions of the library and remove the potential adaptor dimers, the generated sRNA library was separated by electrophoresis with a 6% TBE gel (Novex, #EC6265BOX). The region containing DNA bands from 147 bp to 157 bp long (corresponding to 20-30 nt sRNA size) was excised with a knife and then resolved in elution buffer (0.5 M ammonium acetate, 10 mM magnesium sulfate, 1 mM EDTA (pH 8.0), 0.1% SDS) for 4 hours at 37°C. The remaining fragments of polyacrylamide were removed by passing the supernatant through a disposable plastic column. Two volumes of ethanol at 4°C were added to the solution and then stored on ice for 30 min. DNA was recovered by centrifugation for 10 min at 4°C in one microcentrifuge tube. Finally, the DNA was washed with 70% ethanol and resolved in Tris-EDTA (TE) buffer (pH 7.6).
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
sRNA-seq
|
| Data processing |
For BS-seq reads,low-quality reads, adaptor sequence and the the first 9 bp of 5’ end of each reads were removed using TrimGalore version 0.4.1 with default parameters. Filtered reads were then mapped to the Arabidopsis genome (TAIR10) using Bismark version 0.22.2(ref). Duplicated reads were removed using the Picard tools MarkDuplicates version 1.141 (https://github.com/broadinstitute/picard). Subsequent DNA methylation analysis was performed as previously described (ref).
For sRNA-seq, adaptor trimming was performed using Cutadapt( -u 1 -m 21 -M 25 -a TGGAATTCTCGGGTGCCAAGG ). Clean sRNA reads with lengths between 21-nt and 25-nt inclusive were then mapped to TAIR10 Arabidopsis reference genome using Bowtie (ref) with either 0 mismatches (-v 0) or up to 3 mismatches (-v 3). Abundance of 24-nt siRNA at each Hyper TE, cRdDM or MetGene locus was calculated using Reads Per Kilobase per Million (RPKM) of total mapped 24-nt sRNA reads.
For RNA-seq, low-quality reads and potential adaptor sequence were first trimmed using TrimGalore version 0.4.1 with default parameters. RNA-seq reads were mapped to the reference genome with the TopHat-2.0.10 and Cufflinks-2.2.1 packages.
Genome_build: TAIR10
Supplementary_files_format_and_content: gff files
|
| |
|
| Submission date |
Nov 17, 2020 |
| Last update date |
Jul 02, 2021 |
| Contact name |
Xiaoqi Feng |
| E-mail(s) |
xiaoqi.feng@jic.ac.uk
|
| Organization name |
John Innes Centre
|
| Department |
Cell and Developmental Biology
|
| Lab |
Xiaoqi Feng
|
| Street address |
Norwich Research Park
|
| City |
Norwich |
| State/province |
Norfolk |
| ZIP/Postal code |
NR4 7UH |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL19580 |
| Series (1) |
| GSE161625 |
Nurse cell-derived small RNAs define paternal epigenetic inheritance in Arabidopsis |
|
| Relations |
| BioSample |
SAMN16816925 |
| SRA |
SRX9520894 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM4911387_WT_tapetum_rep1_24nt_sRNA_abundance.w1.gff.gz |
13.1 Mb |
(ftp)(http) |
GFF |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
