|
| Status |
Public on Sep 15, 2021 |
| Title |
Case7 |
| Sample type |
SRA |
| |
|
| Source name |
canine acanthomatous ameloblastoma tumor
|
| Organism |
Canis lupus familiaris |
| Characteristics |
breed: Mixed
Sex: Male
dog age: 6
sample type: CAA
sample location: Rostral mandible
|
| Treatment protocol |
none
|
| Growth protocol |
Tumor biopsies were collected during standard-of-care surgical procedures, and stored by the Cornell Veterinary Biobank at Cornell University’s College of Veterinary Medicine
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cryopreserved tissue was homogenized in Trizol on a bead mill using 2.8mm ceramic beads. Total RNA was isolated from the Trizol lysate, with an extra chloroform extraction to remove residual phenol and addition of glyco-blue as a carrier to promote RNA precipitation. RNA concentration was determined with a Nanodrop and integrity assessed on a Fragment Analyzer.
Directional RNA-seq libraries were prepared from 250ng total RNA using the NEBNext Directional Ultra II RNA Library Prep Kit for Illumina (New England Biolabs), with initial polyA+ enrichment.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
genes.read_group_tracking:CAA_10
|
| Data processing |
Illumina pipeline software was used for base calling.
cutadapt v1.8.3 (-m 50 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTC --match-read-wildcards) was used to trim and filter reads.
tophat v2.1.1 (--no-novel-juncs --library-type fr-firststrand) was used to map reads to the canine CanFam3 reference genome+transcriptome (UCSC).
cuffdiff v2.2.1 (--library-type fr-firststrand) was used to call differentially expressed genes based on the CanFam3 reference genome+transcriptome (Ensembl).
Genome_build: CanFam3 (Ensembl)
Supplementary_files_format_and_content: Tab delimited text files are standard cuffdiff2 output files for gene-level analysis, including counts, FPKM values, and q-values for differential expression testing (corrected for multiple hypothesis testing). The 'gene_exp.diff' file contains average FPKM values for each pair of replicates as well as results for statistical testing for differential expression. The 'genes.read_group_tracking' file contains raw mapped read counts and FPKM values for individual samples.
|
| |
|
| Submission date |
Jun 01, 2021 |
| Last update date |
Sep 15, 2021 |
| Contact name |
Jennifer K Grenier |
| Organization name |
Cornell University
|
| Department |
Biomedical Sciences
|
| Lab |
Biotechnology Building rm 333
|
| Street address |
526 Campus Rd
|
| City |
Ithaca |
| State/province |
NY |
| ZIP/Postal code |
14853 |
| Country |
USA |
| |
|
| Platform ID |
GPL21400 |
| Series (1) |
| GSE175876 |
Transcriptional profiling of canine acanthomatous ameloblastoma |
|
| Relations |
| BioSample |
SAMN11478855 |
| SRA |
SRX5726312 |
