|
| Status |
Public on Oct 05, 2021 |
| Title |
E12.5 PFL Del(CBS1-5) RNAseq rep1 |
| Sample type |
SRA |
| |
|
| Source name |
Proximal forelimb
|
| Organism |
Mus musculus |
| Characteristics |
developmental stage: E12.5
tissue: Proximal forelimb
strain: B6CBAF1
genotype: Del(CBS1-5)
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
Micro-dissected individual pairs of either control or mutant E12.5 proximal and distal forelimbs were stored at -80˚C in RNAlater stabilization reagent (Ambion) before further sample processing. Total RNA was extracted from tissues using Qiagen RNeasy Plus Micro Kit (Qiagen) after disruption and homogenization according to manufacture instructions. RNA quality was assessed using an Agilent 2100 Bioanalyser.
The sequencing libraries were prepared according to TruSeq Stranded mRNA Illumina protocol, with polyA selection. RNA-seq libraries were sequenced on an Illumina HiSeq 4000 sequencer, as single-end reads (read length 50 bp).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Data processing |
Raw RNA-seq reads were processed with cutadapt version 1.16 (Martin 2011 -a CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -q 30 -m 15) to remove TruSeq adapters and bad quality bases.
Filtered reads were mapped on the mouse genome mm10 with STAR version 2.7.0.e (Dobin et al. 2013) with ENCODE parameters with a custom gtf file (https://doi.org/10.5281/zenodo.4596489) based on Ensembl version 102.
FPKM values were evaluated by cufflinks version 2.2.1 (Tranell et al. 2010 Roberts et al. 2011 with options --max-bundle-length 10000000 --multi-read-correct --library-type "fr-firststrand" -b mm10.fa --no-effective-length-correction -M MTmouse.gtf -G).
All counts were merged in a single file. Same for FPKM and multiple entries with the same gene_id were summed.
Strand specific coverage were obtained with bedtools version 2.27.1 on a filtered BAM with only uniquely mapped reads.
Genome_build: mm10
Supplementary_files_format_and_content: AllCufflinks_Simplified.txt: table with all FPKM values
Supplementary_files_format_and_content: AllHTSeqCounts_subset.txt: gene counts obtained by STAR from autosomal genes.
Supplementary_files_format_and_content: _Uniq_fwd.bw: forward strand coverage
Supplementary_files_format_and_content: _Uniq_rev.bw: reverse strand coverage
|
| |
|
| Submission date |
Aug 03, 2021 |
| Last update date |
Oct 05, 2021 |
| Contact name |
Lucille Lopez-Delisle |
| E-mail(s) |
lucille.delisle@epfl.ch
|
| Organization name |
EPFL
|
| Street address |
Station 19
|
| City |
Lausanne |
| ZIP/Postal code |
1015 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL21103 |
| Series (2) |
| GSE181385 |
Cumulative in-cis mutagenesis in vivo reveals various functions for CTCF sites at the mouse Hoxd cluster [RNA-seq] |
| GSE181387 |
Cumulative in-cis mutagenesis in vivo reveals various functions for CTCF sites at the mouse Hoxd cluster |
|
| Relations |
| BioSample |
SAMN20554961 |
| SRA |
SRX11642620 |
