 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Mar 05, 2022 |
| Title |
PGCLC_d3ag3_rep2 |
| Sample type |
SRA |
| |
|
| Source name |
Primordial germ cell-like cell
|
| Organism |
Rattus norvegicus |
| Characteristics |
strain: Crlj:WI
genotype: Wild type
cell type: Primordial germ cell-like cell
|
| Growth protocol |
Rat ESCs were maintained on mouse embryonic fibroblast feeders in rat ESC medium: N2B27 containing 2i (PD0325901, 1 µM, AXON; CHIR99021, 3 µM, AXON) and rat LIF (1,000 U/ml, Merck). They were routinely passaged every 2-3 days.
For rat EpiLC induction, rat ESCs were dissociated into single cell using 0.25% Trypsin-EDTA. Then, the cells were harvested in a well of 96-well Nunclon Sphera-Treated U-shaped microplate (Thermo Fisher Scientific) filled with freshly made EpiLC medium containing KSR(1%), Activin A (20 ng/ml) and bFGF(12 ng/ml), at 4 x 103 cells per well, and cultured for 60 hours.
For rat PGCLC induction, rat EpiLC-aggregates were transferred into new well of 96-well Nunclon Sphera-Treated U-shaped microplate filled with freshly made PGCLC medium composed of N2B27 containing BMP4 (500 ng/ml; PEPRO TECH), rat LIF (1000 U/ml; Merck), SCF (100 ng/ml; R&D systems), EGF (50 ng/ml; R&D systems). At day 3, Nanos3-T2A-tdTomato positive PGCLCs were FACS-sorted for RNA extraction.
For rat PGCLC aggregation, N3T(+) d3 rPGCLCs sorted by FACS were mixed with E15.5 female rat gonadal somatic cells depleted c-KIT positive rPGCs, at 5,000 rPGCLCs to 50,000 somatic cells. Mixed suspensions were plated into a 96-well Nunclon Sphera-Treated U-shaped microplate (Thermo Fisher Scientific) in N2B27 medium containing 5% KSR. At day 3 after aggregation (d3ag3), Nanos3-T2A-tdTomato positive PGCLCs were FACS-sorted for RNA extraction.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was extracted using PicoPure RNA Isolation Kit (Thermo Fisher Scientific) according to manufacturer’s protocols.
RNA-seq libraries were prepared using the SMART-Seq v4 Ultra Low Input RNA Kit (Takara Bio) and KAPA Hyper Prep Kit (Kapa Biosystems).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
Rat_Gene-Exp_ESC-EpiLC-PGCLC_log2(TPM+1).txt
|
| Data processing |
>Basecalls were performed using NextSeq 500/550 RTA software, v.2.4.11-2.11.6.
>FASTQ files were generated using bcl2fastq, v.2.20
>The first 3 bases were trimmed out from raw reads using FASTX-Toolkit 0.0.14
>Trimmed reads were further quality-trimmed using Cutadapt v.1.1.6 program with the following configurations: trimming of the primer sequence "Clontech SMART CDS Primer II A: AAGCAGTGGTATCAACGCAGAGTAC", minimal base quality is 20, minimal read length after trimming is 35 nt
>RNA-seq reads were aligned to the rn7 Rat genome assembly using Hisat2, v.2.1.0
>featureCounts (Subread, v1.6.5) program and Refseq gene annotation (rn7, 33294 genes) were used to calculate TPM values
>TPM values of all protein-coding gene (22228 genes) were log2-transformed (log2(TPM+1) values).
Genome_build: rn7
Supplementary_files_format_and_content: A single text file that lists coding gene log2(TPM+1) values for each sample
|
| |
|
| Submission date |
Nov 22, 2021 |
| Last update date |
Mar 05, 2022 |
| Contact name |
Hisato Kobayashi |
| E-mail(s) |
hiskobay@naramed-u.ac.jp
|
| Phone |
+81-744-29-8015
|
| Organization name |
Nara Medical University
|
| Department |
Department of Embryology
|
| Street address |
840 Shijo-Cho
|
| City |
Kashihara |
| State/province |
Nara |
| ZIP/Postal code |
634-8521 |
| Country |
Japan |
| |
|
| Platform ID |
GPL20084 |
| Series (1) |
| GSE178701 |
Functional primordial germ cell-like cells from pluripotent stem cells in rats |
|
| Relations |
| BioSample |
SAMN23383862 |
| SRA |
SRX13190957 |
| Supplementary data files not provided |
SRA Run Selector |
| Processed data provided as supplementary file |
| Raw data are available in SRA |
|
|
|
|
 |
