|
| Status |
Public on Jun 22, 2024 |
| Title |
Ramos_ATAC_merge |
| Sample type |
SRA |
| |
|
| Source name |
Ramos
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: Ramos
genotype: wt_RIEP
|
| Treatment protocol |
None
|
| Growth protocol |
Ramos cells were cultured in complete RPMI medium
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
ATAC-seq was performed as previously described (Buenrostro et al., 2013) with minor modifocations in the tagmentation step where we used a homemade Tn5 enzyme and assembeld the Tn5-adapter tagmentation mix ourselves. However, the adapter sequences and primers used for library amplification are the same as in the Buenrostro et al. protocol.
transposed DNA was amplified with RT-qPCR monitoring to avoid oveamplification and the libraries were purified with AMPure XP beads.
|
| |
|
| Library strategy |
ATAC-seq |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
Native chromatin was transposed with transposase 5 enzyme
Libraries were prepared following standard Illumina protocols
ATAC-Seq
|
| Data processing |
ATACSeq
The illumina reads were adapter trimmed on their 3’ ends with cutadapt (version 1.15; --match-read-wildcards -O 1 -f fastq -a CTGTCTCTTATACACATCTCCGAGCCCACGAGAC for read1 and cutadapt --match-read-wildcards -O 1 -f fastq -a CTGTCTCTTATACACATCTGACGCTGCCGACGA for read2).
The paired end trimmed reads larger then 18nt were aligned with bowtie2 (version 2.1.0; --sensitive -p 10 -X 5000 -N 0 --trim5 0 --trim3 0) to the human hg38 genome.
The aligned reads were sorted by position with samtools (version 0.1.19).
Strand specific and undirected occupancy profiles were generated with deeptools bamCoverage v2.2.2.
Assembly: NCBI hg38
Supplementary files format and content: bigWig of rpm-normalized read densities
|
| |
|
| Submission date |
May 02, 2022 |
| Last update date |
Jun 22, 2024 |
| Contact name |
Maximilian Christian von der Linde |
| E-mail(s) |
maximilian.linde@imp.ac.at, max_vdl@outlook.com
|
| Phone |
+4368181646556
|
| Organization name |
Institute of Molecular Pathology
|
| Lab |
Pavri GRP
|
| Street address |
Campus-vienna-biocenter 1, IMP, Pavri GRP
|
| City |
Vienna |
| State/province |
Vienna |
| ZIP/Postal code |
1030 |
| Country |
Austria |
| |
|
| Platform ID |
GPL16791 |
| Series (2) |
| GSE202037 |
High-resolution transcriptional analysis of immunoglobulin variable regions reveals the absence of direct relationships between somatic hypermutation, nascent transcription and epigenetic marks [ATAC-seq] |
| GSE202042 |
High-resolution transcriptional analysis of immunoglobulin variable regions reveals the absence of direct relationships between somatic hypermutation, nascent transcription and epigenetic marks |
|
| Relations |
| BioSample |
SAMN28036812 |
| SRA |
SRX15106054 |
