 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 13, 2024 |
| Title |
NPC_IMP1_iCLIP_tech_replicate_1_bio_rep2 |
| Sample type |
SRA |
| |
|
| Source name |
hIPSC_derived NPC
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: hIPSC_derived NPC
cell type: Neuronal progenitor
antibody: Rabbit anti-IMP1 (MBL, RN007P)
treatment: Neuronal differentiation protocol
|
| Extracted molecule |
total RNA |
| Extraction protocol |
iCLIP was performed as previously described (Huppertz et al. 2014) with minor modifications. Briefly, three biological and three technical replicates for NPCs and neurons were cross-linked at 300mJ and then lysed in 1ml of IP lysis buffer. RNA fragmentation was performed with 0.4 units of RNase I (Thermo Scientific, EN0602) and 4μl Turbo DNase I (Ambion, AM223) added to 1mL of protein lysate at a concentration of 1mg/mL. Ideal RNAse concentration was previously determined using a concentration gradient: low (0.4U), medium (0.8U) high (2.5 U) to 1 mg of protein lysate from NPC and neuron. Ideal IMP1 antibody was previously determined using 1μg or 5μg of antibody to 1 mg of protein lysate. To separate protein-RNA complexes, samples were incubated with 5μg of anti-IMP1 antibody or 5μg of anti-IgG (negative control) coupled to Protein G beads (Dynal) at 4°C ON rotating head over tail.
Librarires were prepared by ligating RNA to a pre-adenylated infrared labelled IRL3 adaptor (Zarnegar et al., 2016) with the following sequence: /5rApp/AG ATC GGA AGA GCG GTT CAG AAA AAA AAA AAA /iAzideN/AA AAA AAA AAA A/3Bio/. The protein-RNA complexes were then size-separated by SDS-Page, blotted onto nitrocellulose and visualised by Odyssey scanning (LI-COR). Desired region (determined from the RNAse gradient experiment) was cut from the membrane in small pieces and RNA was released from the membrane by proteinase K (Roche, 03115828001) digestion and incubation at 60 min at 50°C. RNA was recovered by Phenol Chloroform precipitation. cDNA was synthesised with Superscript IV Reverse Transcriptase (Life Technologies). Reverse transcription was performed with primers containing UMIs and barcode (XXXXX) to allow multiplexing: /5Phos/ WWW XXXXX NNNN AGATCGGAAGAGCGTCGTGAT /iSp18/ GGATCC /iSp18/ TACTGAACCGC. cDNA molecules were purified using AMPure XP beads (Beckman-Coulter, USA), then circularised using Circligase II (Epicenter) followed by AMPure XP beads purification. After PCR amplification, libraries were size-selected by gel-purification and size distribution was assessed using Agilent 2400 Bioanalyser. Libraries were quantified by QuBit dsDNA HS Assay. Library composed of the same quantity of cDNA for each sample was sequenced as single-end 100bp reads on Illumina HiSeq 4000
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Data processing |
library strategy: iCLIP
iCLIP reads were processed according to iCLIP analysis methods using the iMaps webserver (https://imaps.genialis.com/iclip ) for standardised primary analysis. iMaps is based on the icount package. Briefly, the following steps were performed: demultiplexing using experimental barcodes, UMI identification, adapter trimming, STAR pre-mapping to rRNAs and tRNAs, STAR alignment to genome and crosslink sites assignment. Significant crosslink sites were defined using the ‘iCount peaks’ tool on the iMaps web server while
Peaks were called using the paraclu package. Peaks were defined by clustering the significant crosslink sites using iMAPS default parameters
Control quality checks (FastQC 0.11.7, https://www.bioinformatics.babraham.ac.uk/projects/fastqc/, PCR duplication ratio, quality of sequencing and alignment statistics from iMaps) were performed on each individual sample.
Assembly: GRCh38.p13 human genome
Supplementary files format and content: Bed file containing crosslink sites
Supplementary files format and content: Bedgraph file containing peaks
|
| |
|
| Submission date |
May 23, 2022 |
| Last update date |
Apr 13, 2024 |
| Contact name |
Pierre Klein |
| E-mail(s) |
klein.pierre1@gmail.com
|
| Organization name |
University College London
|
| Department |
Institute of Structural and Molecular Biology
|
| Street address |
Gower Street
|
| City |
London |
| ZIP/Postal code |
WC1E 6XA |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL20301 |
| Series (2) |
| GSE203569 |
m6a methylation drives IMP1 regulation during human neuronal differentiation [iCLiP] |
| GSE203571 |
m6a methylation drives IMP1 regulation during human neuronal differentiation. |
|
| Relations |
| BioSample |
SAMN28596418 |
| SRA |
SRX15412585 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM6176382_IMP1-ipsc-npc-sample4_XL.bed.gz |
8.5 Mb |
(ftp)(http) |
BED |
| GSM6176382_IMP1-ipsc-npc-sample4_peak.bedgraph.gz |
8.4 Mb |
(ftp)(http) |
BEDGRAPH |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
