|
Status |
Public on May 23, 2024 |
Title |
Exp3-RNA-R1 |
Sample type |
SRA |
|
|
Source name |
NCTC11168
|
Organism |
Campylobacter jejuni |
Characteristics |
tissue: NCTC11168 genotype: wild-type treatment: untreated
|
Treatment protocol |
Bacteria were untreated or treated with chloramphenicol, retapamulin, oncocin, or apidaecin 137
|
Growth protocol |
Bacteria were grown in Brucella broth at 37°C in a microaerobic atmosphere until log phase
|
Extracted molecule |
total RNA |
Extraction protocol |
size-selected RNA from rRNA depleted total RNA or ribosome footprints generated bz micrococcal nuclease small RNA or adaptor ligation protocol
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina NextSeq 500 |
|
|
Description |
rRNA depleted total RNA, approx 26-34 nt
|
Data processing |
For Exp1, Basecalling was done with RTA version 2.4.11 For Exp2 and Exp3, Basecalling was done using RTA version 2.11.3 Adapter sequence "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC" was trimmed using cutadapt 2.1 (HRIBO 1.4.4) Mapping with segemehl 0.3.4 (HRIBO 1.4.4) rRNA filtering with samtools 1.9 (HRIBO 1.4.4) Coverage file creation with HRIBO 1.4.4 wig files were generated with full read or single nucleotide mapping wig files were normalized using the Counts Per Million (CPM) method and converted to bigwig format Assembly: ASM908v1 Supplementary files format and content: bigwig format files containing CPM normalized read coverage for each sample Supplementary files format and content: bigwig format files containing CPM normalized read coverage with specific read-length restrictions for each sample
|
|
|
Submission date |
Jul 21, 2022 |
Last update date |
May 23, 2024 |
Contact name |
Rick Gelhausen |
E-mail(s) |
gelhausr@informatik.uni-freiburg.de
|
Organization name |
Albert-Ludwigs-University Freiburg
|
Department |
Department of Computer Science
|
Lab |
Bioinformatics Group (AG Backofen)
|
Street address |
Georges-Köhler-Allee 106
|
City |
Freiburg |
State/province |
Baden Württemberg |
ZIP/Postal code |
79110 |
Country |
Germany |
|
|
Platform ID |
GPL26884 |
Series (1) |
GSE208756 |
Complementary Ribo-seq approaches refine the translatome and provide a small protein census in a bacterial pathogen |
|
Relations |
BioSample |
SAMN29872829 |
SRA |
SRX16542934 |