|
| Status |
Public on Dec 11, 2010 |
| Title |
KM-H2 cells, CIITA-BX648577 knockdown, replicate 1 |
| Sample type |
RNA |
| |
|
| Source name |
Hodgkin lymphoma cell line KM-H2
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: KM-H2
treatment: CIITA-BX648577 knockdown
|
| Treatment protocol |
RNA interference (RNAi) with the CIITA-BX648577 fusion transcript was performed using lentiviral transduction of a vector (pGIPZ-sh.FLJ27352, clone V2LHS_212659, Thermo Scientific Open Biosystems, Huntsville, AL, USA) expressing a small hairpin RNA (shRNA: TGCTGTTGACAGTGAGCGCGACAGCCACCTCACTATCAAATAGTGAAGCCACAGATGTATTTGATAGTGAGGTGGCTGTCTTGCCTACTGCCTCGGA) that, after processing to mature siRNA, interferes with BX648577 exon 2 sequence as part of the CIITA-BX648577 fusion transcript.
|
| Growth protocol |
KMH2: Standard conditions (www.dsmz.de)
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Qiagen Allprep extraction columns
|
| Label |
biotin
|
| Label protocol |
Biotinylated cRNA were prepared according to the standard Affymetrix protocol (1-cycle)
|
| |
|
| Hybridization protocol |
Following fragmentation, cRNA were hybridized O/N at 45C on Affymetrix GeneChip HG 2.0 Plus Arrays. GeneChips were washed and stained in the Affymetrix Fluidics Station 450.
|
| Scan protocol |
GeneChips were scanned using Affymetrix GeneChip Scanner
|
| Description |
Pleural effusion cells
Gene expression data of transduced KM-H2 cells
|
| Data processing |
The data were analyzed using DCHIP, http://biosun1.harvard.edu/complab/dchip/
|
| |
|
| Submission date |
Dec 10, 2010 |
| Last update date |
Dec 11, 2010 |
| Contact name |
Christian Steidl |
| E-mail(s) |
csteidl@bccancer.bc.ca
|
| Phone |
1-604-675-8046
|
| Organization name |
BC Cancer Agency
|
| Department |
Pathology
|
| Lab |
Steidl lab
|
| Street address |
675 West 10th Avenue
|
| City |
Vancouver |
| State/province |
BC |
| ZIP/Postal code |
V5Z 1L3 |
| Country |
Canada |
| |
|
| Platform ID |
GPL570 |
| Series (2) |
| GSE25987 |
Gene expression profiling of Hodgkin lymphoma cell line KMH2: Comparison of CIITA-BX648577 knockdown cultures with non-silencing controls |
| GSE25990 |
Hodgkin lymphoma |
|
