|
| Status |
Public on Jul 03, 2012 |
| Title |
Oryza sativa L. ssp. japonica rdr701-1_LT panicle sRNA |
| Sample type |
SRA |
| |
|
| Source name |
young panicles (4cm)
|
| Organism |
Oryza sativa |
| Characteristics |
background variety: zhonghua11
genotype/variation: rdr701-1 mutant
tissue: panicle
|
| Treatment protocol |
Collected materials were ground into a fine powder in liquid nitrogen and processed following with Trizol reagent (Invitrogen) kit to extract total RNA.
|
| Growth protocol |
The panicles were collected from plants which were grown on field.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was extracted from panicles using Trizol reagent (Invitrogen). The low molecular weight (LMW) RNA was enriched by adding equal volume of 8M LiCl, incubating on ice for 1 hour and centrifuging at 12,000 rpm for 5 min at 4°C. Approximately 150µg of low molecular weight RNA was resolved in formamide and loaded into 15% PAGE gel with 7M urea and 1×TBE buffer. The gel fragments ranging between 15-30 nt were excised from gel for further purification. The purified small RNA was then ligated with a 5’ adaptor GUUCAGAGUUCUACAGUCCGACGAUC using T4 RNA ligase (NEB) at 20℃ for 6 hours and the ligation product ranging between 40-60 nt was purified again. The purified product was further ligated to the 3’ adaptor pUCGUAUGCCGUCUUCUGCUUGidT, which has a phosphate group in the 5’ terminal and an inverted deoxythymidine in the 3’ terminal, using T4 RNA ligase. The 2nd ligation product between 60-90 nt was separated within 10% Urea-PAGE gel and the purified product was reverse transcription (RT) using primer CAAGCAGAAGACGGCATACGA. The RT product was then amplified by PCR using p5 (AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA) and p7 (CAAGCAGAAGACGGCATACGA) primers for 15 cycles. The amplified products (90-95 nt) was excised from a 6% PAGE gel without urea and purified eventually. The purified product was resolved in 1×TE buffer and submitted to SBS sequencing after quality control (QC) assay in Beijing Genomics Institution.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer |
| |
|
| Description |
high-throughput sequencing of small RNA
|
| Data processing |
The raw data was acquired by Illumina base calling, and all the reads containing ambiguous 'N' were eliminated from raw data. Data that remained was submitted to our following bioinformatics study, including sRNA annotation, phasiRNA prediction and motif analysis etc.
|
| |
|
| Submission date |
Jan 03, 2011 |
| Last update date |
May 15, 2019 |
| Contact name |
xiaofeng cao |
| E-mail(s) |
xfcao@genetics.ac.cn
|
| Phone |
86-10-64869203
|
| Organization name |
Institute of Genetics and Developmental Biology
|
| Department |
State Key Laboratory of Plant Genomics
|
| Street address |
West Lincui Road, Chaoyang District
|
| City |
Beijing |
| ZIP/Postal code |
100101 |
| Country |
China |
| |
|
| Platform ID |
GPL9147 |
| Series (1) |
| GSE26405 |
Roles of RDR701 and DCLs in Rice PhasiRNA biogenesis |
|
| Relations |
| SRA |
SRX037178 |
| BioSample |
SAMN00189471 |
