 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on May 01, 2023 |
| Title |
Wild type_4h_bio rep 2 |
| Sample type |
SRA |
| |
|
| Source name |
diploids
|
| Organism |
Saccharomyces cerevisiae |
| Characteristics |
cell type: diploids
strain: SKY6066
developmental stage: time = 4 hr in meiosis
genotype: Wild type
treatment: S1-seq
index: CGATGT
|
| Growth protocol |
Cells were grown in YPA (1% yeast extract, 2% Bacto Peptone, 1% potassium acetate) for 14 hr at 30°C, harvested, resuspended to OD600=6.0 in 2% potassium acetate and sporulated at 30°C.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Genomic DNA was extracted in low-melting point (LMP) agarose to yield intact high molecular weight DNA. Each cell pellet was resuspended in 150 μl 50 mM EDTA pH 8.0 and allowed to thaw at 40°C. 498 μl LMP agarose (2% in 50 mM EDTA pH 8.0) was mixed with 102 μl Solution 1 (SCE (1 M sorbitol, 0.1 M sodium citrate, 60 mM EDTA pH 7.0) plus 5% β- mercaptoethanol and 1 mg/ml zymolyase 100T) and the mix was prewarmed at 40°C before adding to the cells. The resuspended cells were pipetted into plug molds and chilled at 4°C for 30 min. Once solidified, the agarose plugs (three at a time) were expressed into 3 ml of Solution 2 (0.45 M EDTA pH 8.0, 0.01 M Tris-HCl pH 7.5, 7.5 % β-mercaptoethanol, 10 μg/ml RNase A) and incubated at 37°C for 1 h. Solution 2 was then replaced with Solution 3 (0.25 M EDTA pH 8.0, 0.01 M Tris-HCl pH 7.5, 1% SDS, 1 mg/ml proteinase K) and plugs were incubated at 50°C overnight. Plugs were finally washed three times with 3 ml 50 mM EDTA pH 8 and stored in plug storage solution (0.05 M EDTA pH 8.0, 50% glycerol) at -20°C until all plugs were ready to be processed for library preparation.
Ten plugs of each sample to be analyzed were equilibrated in 500 μl 1× S1 buffer (50 mM sodium acetate pH 4.5, 0.28 M NaCl, 4.5 mM ZnSO4) per plug in 2 ml conical tubes for 30 min and this was repeated three times. Fresh 1× S1 buffer (500 ul) containing 9 U of S1 nuclease (Promega) was added to each tube and the plugs were incubated on ice for 15 min to allow the enzyme diffuse into the plugs, followed by 20 min incubation at 37°C. S1 nuclease was inactivated by addition of EDTA pH 8.0 to a final concentration 10 mM and incubation on ice for 15 min. Plugs were rinsed with 1× TE and further equilibrated in 500 μl T4 polymerase buffer (1× T4 DNA ligase buffer (NEB), 1× BSA, 100 μM dNTPs), four times for 30 min each. Fresh T4 polymerase buffer (500 μl) containing 30 U of T4 DNA polymerase (NEB) was added to each tube and the plugs were incubated on ice for 15 min, followed by 30 min incubation at 12°C. T4 polymerase was inactivated by addition of EDTA pH 8.0 to a final concentration of 10 mM and incubation on ice for 15 min. At this point all buffer was aspirated,the plugs were rinsed with 1× TE and incubated at 75°C for 20 min to fully inactivate T4 polymerase. Plugs were allowed to gradually cool and solidify, before equilibrating in 250 μl 1× T4 ligase buffer (NEB), four times for 15 min each. After the last equilibration step, 200 μl of the buffer were removed leaving each plug immersed in 50 μl 1× T4 DNA ligase buffer, to which 1 μl of 50 μM adaptor and 1 μl of 2000 U/μl T4 DNA ligase were added. Ligation took place at 4°C for ≥18 h. The adaptor was prepared the day of the experiment by mixing oligos P5-top (5BiosG/ACACTCTTTCCCTACACGACGCTCTTCCGATCT, biotin attached to the 5′- end of the oligo) and P5-bottom (5Phos/AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT/3InvdT, 5′- end phosphorylated with inverted dT incorporated at the 3′-end to block ligation) at equimolar concentration, boiling for 5 min and cooling down at room temperature for at least 1 h. To retrieve the DNA from the agarose plugs, the Epicentre GELase Enzyme Digestion protocol was used, followed by phenol extraction and ethanol precipitation. During this process plugs of DNA from a single culture and time point were pooled. The purified DNA was then subjected to size selection by electrophoresis through a 1% LMP 1× TAE agarose gel at 80 V/cm for 2 h to separate the high-molecular-weight genomic DNA from the excess unligated adaptor. The genomic DNA was excised and extracted from the gel using the Epicentre GELase enzyme protocol, phenol extraction and ethanol precipitation; then the DNA was dissolved in 100 μl 1× TE. To ensure complete removal of unligated adaptor, each sample was further purified by passing three times through Chroma Spin-1000 (Clontech) columns. The eluates were then subjected to shearing according to the Covaris instrument protocol to DNA fragment sizes ranging between 200-500 bp. Following shearing, fragments containing the biotinylated adaptor were enriched by affinity purification with streptavidin. For each sample, 50 μl of streptavidin M-280 beads (Roche) were used, prewashed twice with 1× TE and twice with 1× B&W (binding and washing buffer, 10 mM Tris-HCl pH 7.5, 1 mM EDTA, 2 M NaCl), according to the manufacturer’s instructions. Binding was carried out at 20°C for 30 min, followed by two washes with 500 μl 1x B&W buffer and two washes with 500 μl 10 mM Tris-HCl pH 7.5. The remaining steps were performed with the DNA fragments still bound to the streptavidin beads. Because sheared ends are not always readily ligatable, an end-repair step was included according to Epicentre’s End-it DNA Repair kit protocol. The beads for each sample were incubated in 100 μl of reaction mix according to manufacturer’s instructions and incubated at 20°C for 45 min. Following washes with 500 μl 1× B&W buffer (twice) and 500 μl 10 mM Tris-HCl pH 7.5 (twice), the beads were incubated in 100 μl of 1× T4 DNA ligase buffer containing 400 U T4 ligase and 1 μM P7 adaptor. The adaptor was prepared by annealing oligos P7 top (5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTCAC/3InvdT) and P7 bottom (GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC) at equimolar concentration, boiling for 5 min and allowing to cool down at room temperature for at least one hour. Ligation of the P7 adaptor was allowed at 20°C for 4 h and was followed by washes with 500 μl 1× TE and 500 μl 10 mM Tris-HCl pH 7.5 (three times each). Beads of each sample were resuspended in 20 μl 10 mM Tris-HCl pH 7.5. Each sample of beads was split into two PCR reactions in a total of 50 μl containing 10 μl of the resuspended beads, 1× Phusion HF buffer, 0.2 mM dNTP, 1 U Phusion HF polymerase (Thermo Scientific), 0.4 μM P5 universal primer (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC T) and 0.4 μM P7 indexed primer (CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTG, shown here with Illumina TruSeq index 1 underlined). PCR was initiated by a denaturation step at 98°C for 30 sec, followed by 16 cycles of amplification (98°C for 10 sec, 65°C for 20 sec, and 72°C for 20 sec). PCR products were pooled, and the DNA was precipitated by adding ammonium acetate to 2.5 M and 2.5 volumes of ice-cold 100% ethanol. Following an overnight incubation at -20°C, the samples were spun at 16000 g for 30 min, washed with ice-cold 70% ethanol, air-dried and dissolved in 20 μl 10 mM Tris, pH 7.5. PCRs from each sample were pooled and separated on a 5% non-denaturing polyacrylamide gel in 1× TBE. The gel piece between 200–600 bp was excised, crushed, and eluted in 300 μl 10 mM Tris pH 8.0 at 37°C overnight. The elution mixture was spun through a SPIN-X column, and DNA was precipitated with ammonium acetate and ethanol as above. The DNA pellet was dissolved in 20 μl 10 mM Tris pH 7.5 and sequenced on the Illumina HiSeq platform (50 bp single-end) in the Integrated Genomics Operation at Memorial Sloan Kettering Cancer Center.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
wt_bio2
|
| Data processing |
Mapping of the reads onto the S288c reference genome (SacCer2) was performed using the SHRiMP mapper50 (gmapper-ls) with arguments: -E -U -n 1 -Q --sam-unaligned --strata -o 10001 -N 20 Before mapping, adaptor sequences were removed using fastx_clipper (http://hannonlab.cshl.edu/fastx_toolkit/) and a custom script. Code used for read processing and mapping is available online at https://github.com/soccin/S1Seq. After mapping, the reads were separated into unique and multiple-mapping sets, but only uniquely mapping reads were analyzed in this study. Analyses were performed using the R package (RStudio version 0.99.879, R version 3.1.2).
Maps were curated by masking (set to NA) 500 bp at the ends of each chromosome, because telomeres represent naturally occurring resected DNA ends and therefore give a high frequency of reads.
We masked regions that gave a high frequency of meiotic DSB-independent reads, defined as positions with more than 10 reads in the high-depth biological replicates and/or more than 5 reads in the lower depth biological replicates from the 0-h maps from wild type, spo11-Y135F, dmc1 null, and exo1-D173A plus the 4-h map from spo11-Y135F. A table of mask coordinates is provided at https://github.com/soccin/S1Seq.
Reads mapping to mitochondrial DNA or the 2 μ plasmid were excluded.
Each map was normalized to reads per million remaining mapped reads (provided here as processed data files) and biological replicates were averaged.
Assembly: Reads were mapped to the SGD assembly released in June 2008, called "SacCer2" by UCSC.
Supplementary files format and content: txt files include RPM (reads per million mapped) for each genotype and biological replicate over the experimental meiotic time points examined. Column names: letter "w" or "c" denotes watson (top) or crick (bottom) strand respectively, followed by a number indicating meiotic time point.
Library strategy: S1-seq
|
| |
|
| Submission date |
Dec 20, 2022 |
| Last update date |
May 02, 2023 |
| Contact name |
Pei-Ching Huang |
| E-mail(s) |
peggylovessinging@gmail.com
|
| Phone |
6464229448
|
| Organization name |
Metagenomi
|
| Street address |
1545 Park Ave
|
| City |
Emeryville |
| State/province |
CA |
| ZIP/Postal code |
94608 |
| Country |
USA |
| |
|
| Platform ID |
GPL13821 |
| Series (1) |
| GSE221377 |
Chromatin remodeler Fun30 promotes efficient DSB end resection and recombination during yeast meiosis |
|
| Relations |
| BioSample |
SAMN32323297 |
| SRA |
SRX18785384 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM6862129_s_sky6066_4h_index2_HITMAP_masked_rpm.Rdata.gz |
4.4 Mb |
(ftp)(http) |
RDATA |
| GSM6862129_s_sky6066_4h_index2_HITMAP_masked_rpm.txt.gz |
32.2 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
