GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM7032252

Query DataSets for GSM7032252

Status

Public on Feb 09, 2023

Title

Cornell2

Sample type

SRA

Source name

testis

Organism

Gallus gallus

Characteristics

tissue: whole testis
breed: Cornell2
age: adult
genotype: wildtype
fraction: genomic DNA

Treatment protocol

Growth protocol

Chickens were used according to guidelines for animal care of the NIH and the University Committee on Animal Resources at the University of Rochester.

Extracted molecule

genomic DNA

Extraction protocol

Total RNAs were extracted using mirVana miRNA Isolation Kit (ThermoFisher, AM1560). Genomic DNA was size selected using the Pippin HT DNA Size Selection System (Sage Science, Beverly, MA, USA).
1, Strand-specific RNA-seq: libraries were constructed following the TruSeq RNA sample preparation protocol. rRNAs were depleted from total RNAs by Ribo-Zero Gold (Epicentre Biotechnologies, Madison, WI, USA). 2, Small RNA-seq: Testes samples were lysed and treated with sodium periodate for library constrution. The 3'-adapter is TGGAATTCTCGGGTGCCAAGG and has been trimmed in the raw data.
1, Strand-specific RNA-seq; 2, Small RNA-seq

Library strategy

OTHER

Library source

genomic

Library selection

other

Instrument model

PromethION

Description

SixRoosterMerged.sorted.bam.Sniffles.1read.vcf.txt.gz

Data processing

Analyses were performed using piPipes v1.4. All data from the small RNA-seq, RNA sequencing, were analyzed using the latest mouse genome release galGal6 (GCA_000002315.5). Generally, one mismatch is allowed for genome mapping.
For RNA-seq reads, the expression per transcript was normalized to the top quartile of expressed transcripts per library calculated by Cuffdiff, and the tpm (transcripts per million) value was quantified using the Salmon software.
For small RNA-seq analysis, uniquely mapping reads excluding rRNA and miRNA between 26 nt and 32 nt were selected for further analysis.
For ONT, the ONT Sequencing data collected in this experiment were obtained as fast5 files, and after conversion of electric signals into base calls via the guppy (Oxford Nanopore Technologies, UK), the reads with mean qScore greater or equal to 7 were kept to continue subsequent bioinformatic analysis. The filtered data were aligned with the chicken genome (galGal6) using NGMLR (v0.27). The SVs were detected using Sniffles (v1.0.8). We also independently used SVIM (v1.4.2 ) to call SVs with default settings.
Assembly: Gallus gallus: galGal6 (GCA_000002315.5)
Supplementary files format and content: For small RNA-seq, processed data files are unique genome alignment results in bigWig result format. RNAseq quantification results are .sf files output by Salmon software. For ONT, processed data files are performed a shuffling test in .txt format.

Submission date

Feb 08, 2023

Last update date

Feb 10, 2023

Contact name

Jiafei Shen

E-mail(s)

shenjiafei0118@yahoo.com

Phone

13201907629

Organization name

International Institutes of Medicine, The Fourth Affiliated Hospital, Zhejiang University School of Medicine