GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM7058361

Query DataSets for GSM7058361

Status

Public on Jul 17, 2023

Title

Peripheral white blood cells, Fertile, 25

Sample type

SRA

Source name

Blood

Organism

Bos taurus

Characteristics

tissue: Blood
pregnancy outcome: Fertile (Pregnant to AI)
cell type: Peripheral white blood cells
breed: Angus-Simmental crossbred

Extracted molecule

total RNA

Extraction protocol

Total RNA was isolated from 14 heifers using Trizol reagent (Invitrogen, Carlsbad, CA, USA) following standard procedures. RNA purification and DNase digestion were done using an RNA clean and concentrator kit (Zymo Research, Irvine, CA, USA). RNA was quantified using a Qubit RNA broad-range assay kit (Eurogene, OR) on a Qubit fluorometer. The RNA integrity was assessed using the Agilent Bioanalyzer and the Agilent RNA 6000 Nano kit (Agilent, Santa Clara, CA, USA). The quality of small RNAs was determined using the Agilent 2100 Bioanalyzer Small RNA kit (Agilent, Santa Clara, CA, USA)
The total RNA of each sample was diluted with RNase-free water to obtain a final concentration of 1 mg as a starting material. This diluted total RNA was used to prepare libraries using the protocols by NEXTflex small RNA-Seq kit v3 (Perkin Elmer). Following the protocol from the kit, the 5’ and 3’ adapters were ligated to the RNA fragments, which were then reverse-transcribed and amplified (18 cycles) to generate cDNA libraries with a unique barcode primer. Libraries were cleaned up using NEXTflex Cleanup beads (gel-free protocol), and the size distribution of the final library was assessed by Agilent Bioanalyzer high-sensitivity DNA assay (Agilent, Santa Clara, CA, USA). The quality-checked libraries were pooled and sequenced in the NextSeq 500 using the single-end 50 bp chemistry at Discovery Life Sciences (Hudson Alpha Institute of Biotechnology, Huntsville, AL, USA).

Library strategy

miRNA-Seq

Library source

transcriptomic

Library selection

size fractionation

Instrument model

Illumina NextSeq 500

Data processing

Raw sequencing data were subjected to a quality check using FastQC v0.11.9 and MultiQC v1.12. The 3’ adapter sequence was trimmed using Cutadapt with the following parameters: -a TGGAATTCTCGGGTGCCAAGG -minimum length 23. The reads were further trimmed using Cutadapt to remove four bases from either side of each read following the small RNA trimming instructions (cutadapt -u 4 -u -4) (recommended by NEXTflex small RNA-Seq kit v3 (Perkin Elmer)). Trimmed Fastq files were checked for quality control with FastQC v0.11.9 and MultiQC v1.12. To profile both novel and known miRNA expression in the samples from the cleaned sequence data, the trimmed reads were processed using the miRDeep2 analysis workflow. Sequences were aligned to Ensembl's ARS-UCD 1.2 Bos taurus reference genome using the mapper.pl module in miRDeep2 and were further aligned with Bos taurus precursor and matured miRNAs extracted from miRBase v22.1 producing raw read counts for each sample. The read counts were transformed to counts per million (CPM) using edgeR v3.28.1. For quality control, raw counts with CPM < 1 in 50% of the samples were filtered out. The differentially expressed miRNAs were identified using DESeq2 v1.26.0.
Assembly: ARS UCD1.2 Bos taurus
Supplementary files format and content: Matrix table with raw counts for all miRNAs and samples in miRNA_raw_counts.txt
Supplementary files format and content: Normalized counts for all miRNAs and samples in miRNA_Normalized.csv

Submission date

Feb 22, 2023

Last update date

Jul 17, 2023

Contact name

Paul W Dyce

E-mail(s)

pwd0003@auburn.edu

Phone

(334) 844-1840

Organization name

Auburn University