 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 05, 2024 |
| Title |
qNHA cells, ATAC, DACPano, BR2 |
| Sample type |
SRA |
| |
|
| Source name |
brain
|
| Organism |
Homo sapiens |
| Characteristics |
tissue: brain
cell line: HA
cell type: Human Astrocytes
treatment: 1uM DAC 6 days, 100nM Pano 2 days
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
We followed the omniATAC protocol (Corces et al., Nature Methods, 2017)
We followed the omniATAC protocol (Corces et al., Nature Methods, 2017)
|
| |
|
| Library strategy |
ATAC-seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
Sequencing reads were trimmed with using Cutadapt (v1.10) with "-a CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -A CTGTCTCTTATACACATCTGACGCTGCCGACGA --quality-cutoff=15,10 --minimum-length=36"
Trimmed reads were aligned to hg38 reference genome using bowtie2 (v2.3.4.1) with " --very-sensitive -X 2000".
Reads aligned to chrM were eliminated.
Duplicated reads were discarded using Picard (v2.8.1, http://broadinstitute.github.io/picard/).
Only properly paired reads with at least 10 mapping quality were retained
hg38
bigwig
|
| |
|
| Submission date |
Mar 09, 2023 |
| Last update date |
Jun 05, 2024 |
| Contact name |
Daofeng Li |
| E-mail(s) |
lidaof@gmail.com
|
| Phone |
(314) 286-0866
|
| Organization name |
Washington University in St. Louis
|
| Department |
Genetics
|
| Lab |
Ting Wang Lab
|
| Street address |
4515 McKinley Avenue
|
| City |
SAINT LOUIS |
| State/province |
MO |
| ZIP/Postal code |
63110 |
| Country |
USA |
| |
|
| Platform ID |
GPL18573 |
| Series (1) |
| GSE227059 |
Epigenetic therapy activates TE-chimeric transcripts to provide additional source of antigens in glioblastoma stem cells |
|
| Relations |
| BioSample |
SAMN33706439 |
| SRA |
SRX19627056 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM7090858_ATAC_qNHA_DACPano_BR2.RPGC_10M.bw |
318.1 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
