 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 05, 2024 |
| Title |
hFB cells, nanoCAGE, DACPano, BR1 |
| Sample type |
SRA |
| |
|
| Source name |
skin
|
| Organism |
Homo sapiens |
| Characteristics |
tissue: skin
cell line: HDFa
cell type: primary dermal fibroblast
treatment: 1uM DAC 6 days, 100nM Pano 2 days
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
mRNA from GSCs and primary cells was extracted using Dynabeads mRNA DIRECT Purification Kit (ThermoFisher Scientific, 61011). We enriched for 5’-capped mRNA by digesting mRNA extraction with Terminator exonuclease digestion (Lucigen, TER51020) following manufacture’s recommendations.
We followed the standard nanoCAGE protocol (Salimullah et al., Cold Spring Harbor Protocol, 2011)
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
CAGE |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
Sequencing reads were trimmed with using Cutadapt (v1.10) with "-a CTGTCTCTTATACACATCTCCGAGCCCACGAGAC -A TGCTGGAGACCTTCAGTTCGACTAGTGTAG --minimum-length 50".
Trimmed reads were aligned using STAR (v2.5.4b) (STAR --runMode alignReads --runThreadN 6 --genomeDir <reference directory> --readFilesIn <R1.fastq.gz> <R2.fastq.gz> --readFilesCommand zcat --outFileNamePrefix <name.out> --outSAMtype BAM SortedByCoordinate --outSAMstrandField intronMotif --outSAMattributes NH HI NM MD AS XS --outSAMunmapped Within --outSAMheaderHD @HD VN:1.4 --outFilterMultimapNmax 20 --outFilterScoreMinOverLread 0.33 --outFilterMatchNminOverLread 0.33 --alignIntronMax 500000 --alignMatesGapMax 1000000 --twopassMode Basic).
hg38
bedgraph
|
| |
|
| Submission date |
Mar 09, 2023 |
| Last update date |
Jun 05, 2024 |
| Contact name |
Daofeng Li |
| E-mail(s) |
lidaof@gmail.com
|
| Phone |
(314) 286-0866
|
| Organization name |
Washington University in St. Louis
|
| Department |
Genetics
|
| Lab |
Ting Wang Lab
|
| Street address |
4515 McKinley Avenue
|
| City |
SAINT LOUIS |
| State/province |
MO |
| ZIP/Postal code |
63110 |
| Country |
USA |
| |
|
| Platform ID |
GPL18573 |
| Series (1) |
| GSE227059 |
Epigenetic therapy activates TE-chimeric transcripts to provide additional source of antigens in glioblastoma stem cells |
|
| Relations |
| BioSample |
SAMN33706424 |
| SRA |
SRX19627071 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM7090873_nanoCAGE_hFB_DACPano_BR1.CTSS_TPM.bedgraph.gz |
17.4 Mb |
(ftp)(http) |
BEDGRAPH |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
