NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM7090907 Query DataSets for GSM7090907
Status Public on Jun 05, 2024
Title NHA cells, mRNA-seq, DMSO, BR1
Sample type SRA
 
Source name brain
Organism Homo sapiens
Characteristics tissue: brain
cell line: HA
cell type: Human Astrocytes
treatment: DMSO
Extracted molecule polyA RNA
Extraction protocol mRNA from GSCs and primary cells was extracted using Dynabeads mRNA DIRECT Purification Kit (ThermoFisher Scientific, 61011). We enriched for 5’-capped mRNA by digesting mRNA extraction with Terminator exonuclease digestion (Lucigen, TER51020) following manufacture’s recommendations.
RNA-seq library was generated using TruSeq RNA Library Prep Kit v.2 (Illumina, RS-122–2001).
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection cDNA
Instrument model Illumina NextSeq 500
 
Data processing Sequencing reads were trimmed with using Cutadapt (v1.10) with " -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT --minimum-length 50 ".
Trimmed reads were aligned using STAR (v2.5.4b) (STAR --runMode alignReads --runThreadN 6 --genomeDir <reference directory> --readFilesIn <R1.fastq.gz> <R2.fastq.gz> --readFilesCommand zcat --outFileNamePrefix <name.out> --outSAMtype BAM SortedByCoordinate --outSAMstrandField intronMotif --outSAMattributes NH HI NM MD AS XS --outSAMunmapped Within --outSAMheaderHD @HD VN:1.4 --outFilterMultimapNmax 20 --outFilterScoreMinOverLread 0.33 --outFilterMatchNminOverLread 0.33 --alignIntronMax 500000 --alignMatesGapMax 1000000 --twopassMode Basic).
hg38
bedgraph
 
Submission date Mar 09, 2023
Last update date Jun 05, 2024
Contact name Daofeng Li
E-mail(s) lidaof@gmail.com
Phone (314) 286-0866
Organization name Washington University in St. Louis
Department Genetics
Lab Ting Wang Lab
Street address 4515 McKinley Avenue
City SAINT LOUIS
State/province MO
ZIP/Postal code 63110
Country USA
 
Platform ID GPL18573
Series (1)
GSE227059 Epigenetic therapy activates TE-chimeric transcripts to provide additional source of antigens in glioblastoma stem cells
Relations
BioSample SAMN33706390
SRA SRX19627083

Supplementary file Size Download File type/resource
GSM7090907_mRNA_NHA_DMSO_BR1.RPKM.bedgraph.gz 55.1 Mb (ftp)(http) BEDGRAPH
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap