 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 13, 2023 |
| Title |
CH12_RNAseq_Rif1KO_clone2_rep1 |
| Sample type |
SRA |
| |
|
| Source name |
CH12
|
| Organism |
Mus musculus |
| Characteristics |
genotype: Rif1KO clone2
|
| Growth protocol |
RNA-seq was performed on CH12 and two independent RIF1-deficient (RIF1-/-) CH12 clonal derivatives 30 with three replicates. Cells were expanded in complete RPMI and 1 million cells were collected by centrifugation
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA was extracted with TRIzol (Invitrogen) according to manufacturer’s instructions.
TruSeq RNA Library Prep Kit v2 (Illumina) was used to prepare a whole-transcriptome sequencing library
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Data processing |
RNA-seq
Read alignment: 3' adaptors or reads were removed using cutadapt (v1.4.2, Read1: cutadapt --match-read-wildcards -O 1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC) and trimmed reads with a length of less than 18bp were discarded.
The trimmed reads were filtered with a contaminants database consisting of rDNA sequences (gi|374088139, gi|38176281) with bowtie2(v2.1.0 --very-sensitive-local).
The recovered non matching reads were aligned to the genome/transcriptome using STAR-align (v2.4.2a, STAR --outSAMstrandField None --outFilterIntronMotifs RemoveNoncanonical --outFilterMismatchNoverLmax 0.1 --outFilterMismatchNmax 10 --outFilterScoreMinOverLread 0.30 --outFilterMatchNminOverLread 0.30 --outFilterMatchNmin 30 --chimSegmentMin 15 --quantMode TranscriptomeSAM --chimJunctionOverhangMin 15 --twopassMode Basic --outSAMtype SAM --outSAMattributes All --outReadsUnmapped Fastx intronMotif --alignIntronMax 200000 --outSJfilterIntronMaxVsReadN 10000 20000 30000 50000 --outSJfilterOverhangMin 20 12 12 12 --outFilterType BySJout --alignMatesGapMax 0 --outFilterMultimapNmax 20).
The STAR-index used for alignment was generated from the combination of the mouse genome build NCBI m37 (GCA_000001635.18) and a transcriptome GTF file created from all refGenes and ensGenes gtfs downloaded from the UCSC Table Browser on the 1. March 2014.
Unique mappers from the resulting BAM file were used to create unstranded, stranded and reverse stranded coverage tracks for visualisation using bedtools (v2.27, bedtools genomecov -split -bg, bedtools genomecov -split -bg -strand '+' ,bedtools genomecov -split -bg -strand '-') and bedGraphToBigWig from the kent-tools (bedGraphToBigWig v4, bedGraphToBigWig -blockSize=256 -itemsPerSlot=1024).
Normalised coverage tracks were created by dividing the coverage at each position with the total number of aligned reads per million.
Differential gene expression analysis: Read counts for genes were quantified using featureCounts v2.0.0.
As a reference, we downloaded all mm9 refSeq genes from the UCSC table browser (https://hgdownload.soe.ucsc.edu/goldenPath/mm9/bigZips/genes/) on February 28, 2020.
In addition, we downloaded the Igh, Igk and Igl gene Ensembl Gene IDs from IMGT (http://www.imgt.org, August 11, 2020) and extracted the corresponding genes from Gencode M25 (www.gencodegenes.org) and lifted them over to mm9 coordinates and added them in addition to the Elambda 3_1 enhancer.
Differential gene expression analysis was performed with DESeq2 v1.22.2 and shrinking log2-foldchanges with ashr v2.2-47.
Assembly: NCBI mm9
Supplementary files format and content: Tab-delimited table with TPMs and DESeq2 log2-foldchanges, adjusted p-values and control TPMs
|
| |
|
| Submission date |
Apr 17, 2023 |
| Last update date |
Jun 13, 2023 |
| Contact name |
Tobias Neumann |
| Organization name |
IMP
|
| Street address |
Campus-Vienna-Biocenter 1
|
| City |
Vienna |
| ZIP/Postal code |
1030 |
| Country |
Austria |
| |
|
| Platform ID |
GPL24247 |
| Series (2) |
| GSE228880 |
RIF1 regulates early replication timing in murine B cells. |
| GSE229885 |
RIF1 regulates replication origin activity and early replication timing in B cells [RNA-seq] |
|
| Relations |
| BioSample |
SAMN34224156 |
| SRA |
SRX19992628 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
