|
| Status |
Public on Jul 31, 2024 |
| Title |
Embryo_RNAseq_Rep1 |
| Sample type |
SRA |
| |
|
| Source name |
Embryo (25 days after anthesis)
|
| Organism |
Oryza sativa |
| Characteristics |
subspecies: Indica
cultivar: Pusa Basmati1 (PB1)
tissue: Embryo (25 days after anthesis)
|
| Treatment protocol |
WT and clsy3 knockdown lines were handled in the same manner.
|
| Growth protocol |
The plants were grown in green house with natural day-night cycles with temperature maintained around 28 degrees celsius.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was isolated from Embryo,Mature Endosperm, Young Endosperm. RNA was extracted using TRIzol method.
Libraries were prepared for sequencing using standard Illumina protocols. The kit used is NEBNext® Ultra™ II Directional RNA Library Prep with Sample Purification Beads (Catalog no-E7765L) and the adapter sequences are Read 1- AGATCGGAAGAGCACACGTCTGAACTCCAGTCA and for read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Data processing |
Adapter was removed and low quality bases were trimmed from sequenced reads using Trimmomatic and rRNA sequences were removed using Sortmerna.
The processed reads were aligned to the rice genome using HISAT2.
Gene expressions were calculated using CuffLinks (v2.2.1) as mentioned in Cole Trapnell et al, 2012.
Assembly: Oryza sativa japonica nipponbare genome – IRGSP1
Supplementary files format and content: Text delimited files including FPKM for each sample.
|
| |
|
| Submission date |
Apr 18, 2023 |
| Last update date |
Jul 31, 2024 |
| Contact name |
Shivaprasad Padubidri V. |
| E-mail(s) |
shivaprasad@ncbs.res.in, epigeneticsncbsindia@gmail.com, harshith200cy@gmail.com
|
| Phone |
+91-80-2366-6511
|
| Organization name |
National Centre for Biological Sciences - TIFR
|
| Street address |
UAS-GKVK Campus
|
| City |
Bangalore |
| ZIP/Postal code |
560065 |
| Country |
India |
| |
|
| Platform ID |
GPL19290 |
| Series (1) |
| GSE229959 |
Upstream regulator of genomic imprinting in rice is a small RNA-associated chromatin remodeler [RNA-seq] |
|
| Relations |
| BioSample |
SAMN34234252 |
| SRA |
SRX20001598 |
