|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on May 02, 2023 |
Title |
NPC, INTS10KO_C10, H3K27ac, biol rep1 |
Sample type |
SRA |
|
|
Source name |
SHSY5Y
|
Organism |
Homo sapiens |
Characteristics |
cell line: SHSY5Y cell type: neuroblastoma genotype: INTS10KO_C10 treatment: No treatment cut&tag antibody: H3K27ac
|
Treatment protocol |
Lentiviruses were produced in HEK293T cells by co-transfection 8 ug of pLentiCRISPR v2-INTS10 gRNA3 (Target sequence: TTCTGAGAGCTACGTTTGCT). iPSCs or SH-SY5Y were passaged into a 6-well plate at 30-40 % confluence. When the cells reached 60-70% confluence, 2 ml of virus medium per well (cell medium with 4 ul of lentiviral particles per ml and 8 ug/ml polybrene (Thermo Fisher, cat#TR1003G)) was added to replace old medium. 24 hours after induction, the virus medium was removed and replaced with fresh cell culture medium for another 48 hours. After that, cells were selected with with 0.5 ug/ml of puromycin in fresh medium (InvivoGen, cat#ant-pr-1). 48 hours after selection with puromycin, iPSC colonies were disassociated with Accutase and passed through a 40 uM cell stainer to to generate single cells. Singel cell suspension with 10 μM of ROCK inhibitor and 0.5 ug/ml of puromycin were seeded in Geltrex-coated 10 cm dishes. ROCK inhibitor was removed 24 hours after the seeding. Single cells were cultured in iPSC medium with 0.5 ug/ml of puromycin for the next 2-3 weeks until iPSC colonies appeared. SH-SY5Y cells after selection with puromycin for 48 hours were trypsinized and plated into 10 cm tissue culture dishes. Single cells were maintained in the basal medium supplemented with 0.5 ug/ml of puromycin for the next 2-3 weeks until cell colonies appeared. Individual microcolonies were moved to a 96-well plate for clonal expansion. Clones were screened by PCR initially ( Primers: INTS10-F, 5'- TATACCAGTGGCCTCTTGTC - 3', INTS10-R, 5' - CGTCTTCCTTTATCCATCTGCC - 3') and verified by Western Blot and Sanger sequencing.
|
Growth protocol |
iPSCs were cultured on Geltrex-coated plates and maintained in StemMACS™ iPS-Brew XF (Miltenyi Biotec, cat#130-104-368). NPCs were differentiated from iPSCs using Neural Induction Medium (98% Neurobasal Meida (ThermoFisher, cat#21103049) and 2% Neuronal Induction Supplementd) for 7 days and maintained in Neural Expansion Medium (49% Neurobasal Meida (ThermoFisher, cat#21103049), 49% Advanced DMEM/F12 (ThermoFisher, cat#12634010) and 2% Neuronal Induction Supplement. SHSY5Y cells were maintained in the basal medium (45% of Minimum Essential Medium (MEM) (Corning, cat#10009CV), 45% of Nutrient Mixture F-12 Ham (Sigma-Aldrich, Cat#N4888) and 10% of fetal bovine serum (Corning, cat#35010CV)).
|
Extracted molecule |
genomic DNA |
Extraction protocol |
Profiling of histone markers in SH-SY5Y cells was performed with CUTANA™ CUT&Tag kit (Epicypher, cat#14-1101) following the manufacturer's protocol. Briefly, desired Concanavalin A (ConA) coated magnetic beads (Bangs Laboratories, cat#BP531) for all planned CUT&Tag reactions (11 μL per reaction) were processed together and activated in cold Bead Activation Buffer (20 mM HEPES, pH 7.9, 10 mM KCl, 1 mM CaCl2, 1 mM MnCl2). 10 ul of activated ConA beads were aliquoted into each 8-strip PCR tubes for individual reactions and kept cold until needed. WT and INTS10 KO SH-SY5Y cells were harvest, counted and centrifuged for 3 min at 600⨉g at room temperature in two individual 1.5 mL tubes. Total desired amount of WT and INTS10 KO cells (200, 000 cells per experiment) were washed once with PBS at room temperature. To isolate nuclei, cell pellets were resuspended in cold Nulcear Extraction buffer (20 mM HEPES–KOH, pH 7.9, 10 mM KCl, 0.1% Triton X-100, 20% Glycerol, 0.5 mM Spermidine, 1 x Protease inhibitor), incubated for 10 min on ice and centrifuged for 3 minutes at 600⨉g at 4 °C to remove the supernatant. Fluffy nuclei pellets were resuspended in 100 μL/reaction cold NE buffer and aliquoted into 8-strip PCR tubes containing 10 μL of activated ConA beads. Nuclei-beads slurry were vortex gently to mix and incubated for 10 minutes at room temperature. 50 μL cold Antibody150 Buffer (20 mM HEPES, pH 7.5, 150 mM NaCl, 0.5 mM Spermidine, 0.01% Digitonin, 2 mM EDTA, 1X protease inhibitor ) containing 0.5 ug of H3K4me1 or H3K27ac antibody was added immediately to the beads after the removal of the supernant and vortex gently and thoroughly. The reactions were incubated on nutator overnight at 4 °C . On the next day, anti-rabbit secondary antibody master mix was prepared first by diluting secondary antibodies in cold Digitonin 150 buffer (20 mM HEPES, pH 7.5, 150 mM NaCl, 0.5 mM Spermidine, 0.01% Digitonin, 1X Protease inhibitor). After removing the supernatant from the beads slurry, 50 μL/reaction cold secondary antibody master mix was added to each reaction and mixed well by gentle vortexing. The reactions were incubated on nutator for 30 minutes at room temperature. After two washes with cold Digitonin 150 buffer (), 50 μL/reaction cold Digitonin 300 buffer (20 mM HEPES, pH 7.5, 300 mM NaCl, 0.5 mM Spermidine, 1 X protease inhibitor, 0.01% Digitonin ) containing 2.5 μL pAG-Tn5 was added to the beads slurry. Beads were thoroughly resuspened by gentle vortexing and incubated on nutator for 1 hour at room temperature. After two washes with 200 μL/reaction cold Digitonin 300 buffer, 50 μL/reaction cold Tagmentation buffer (Digitonin300 Buffer, 10 mM MgCl2 ) was added to each reaction and the tubes were incubated for 1 hour at 37 °C in a thermocycle. 50 μL/reaction RT TAPS buffer (10 mM TAPS, pH 8.5, 0.2 mM EDTA) was then used to wash the reactions and 5 μL/reaction RT SDS Release buffer (10 mM TAPS, pH 8.5, 0.1% SDS) was added to quench the tagmentation reaction. 15 μL/reaction RT SDS Quench buffer (0.67% Triton-X 100 in Molecular grade H2O) was then used to neutralize SDS, which inhibits PCR. Library amplification was performed directly on the entire reaction mixture by adding dual primers and CUTANATM High Fidelity 2x PCR Master Mix. After PCR, the library DNA was purified using AMPure XP beads (ThermoFisher, cat#A63881) and quantified by Qubit. CUT&TAG (Kaya-Okur et al. 2020)
|
|
|
Library strategy |
OTHER |
Library source |
genomic |
Library selection |
other |
Instrument model |
NextSeq 2000 |
|
|
Description |
H3K27ac CUT&TAG in INTS10KO_C10 SHSY5Y
|
Data processing |
Image analysis: Firecrest (Illumina pipeline 1.9, default parameters) Base calling: Bustard (Illumina pipeline 1.9, default parameters) Quality control: FastQC Adapter trimming: Trim Galore! Alignment: bowtie2 Tag density files: deepTools bamCoverage Genome_build: GRCh37/hg19 Assembly: hg19 Supplementary files format and content: Supplementary_files_format_and_content: strand-specific bigWig, compatible with UCSC Genome Browser, generated using the deepTools package (bamCoverage function, with RPGC [reads per genome coverage] normalization)
|
|
|
Submission date |
Apr 28, 2023 |
Last update date |
May 03, 2023 |
Contact name |
Alessandro Gardini |
E-mail(s) |
agardini@wistar.org
|
Phone |
2158983755
|
Organization name |
The Wistar Institute
|
Lab |
Gardini Lab
|
Street address |
3601 Spruce St, Room 230
|
City |
Philadelphia |
State/province |
PA |
ZIP/Postal code |
19104 |
Country |
USA |
|
|
Platform ID |
GPL30173 |
Series (2) |
GSE230889 |
Control of cell identity and early neuronal fate commitment by the enhancer module of Integrator [CUT&TAG] |
GSE230928 |
Control of cell identity and early neuronal fate commitment by the enhancer module of Integrator |
|
Relations |
BioSample |
SAMN34423991 |
SRA |
SRX20140617 |
Supplementary file |
Size |
Download |
File type/resource |
GSM7246558_SHSY5Y-INTS10KO-C10-H3K27ac-CT_STAR_aln_to_genome_q10_srt_DS.bw |
34.1 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
|
|
|
|
|