 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on May 02, 2023 |
| Title |
NPC, INTS10HET2, ATAC, biol rep1 |
| Sample type |
SRA |
| |
|
| Source name |
NPC
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: NPC
cell type: neuronal progenitor cell differentated from pluripotent stem cells
genotype: INTS10HET2
treatment: No treatment
|
| Treatment protocol |
Lentiviruses were produced in HEK293T cells by co-transfection 8 ug of pLentiCRISPR v2-INTS10 gRNA3 (Target sequence: TTCTGAGAGCTACGTTTGCT). iPSCs were passaged into a 6-well plate at 30-40 % confluence. When the cells reached 60-70% confluence, 2 ml of virus medium per well (cell medium with 4 ul of lentiviral particles per ml and 8 ug/ml polybrene (Thermo Fisher, cat#TR1003G)) was added to replace old medium. 24 hours after induction, the virus medium was removed and replaced with fresh cell culture medium for another 48 hours. After that, cells were selected with with 0.5 ug/ml of puromycin in fresh medium (InvivoGen, cat#ant-pr-1). 48 hours after selection with puromycin, iPSC colonies were disassociated with Accutase and passed through a 40 uM cell stainer to to generate single cells. Single cell suspension with 10 μM of ROCK inhibitor and 0.5 ug/ml of puromycin were seeded in Geltrex-coated 10 cm dishes. ROCK inhibitor was removed 24 hours after the seeding. Single cells were cultured in iPSC medium with 0.5 ug/ml of puromycin for the next 2-3 weeks until iPSC colonies appeared.
|
| Growth protocol |
iPSCs were cultured on Geltrex-coated plates and maintained in StemMACS™ iPS-Brew XF (Miltenyi Biotec, cat#130-104-368). NPCs were differentiated from iPSCs using Neural Induction Medium (98% Neurobasal Meida (ThermoFisher, cat#21103049) and 2% Neuronal Induction Supplementd) for 7 days and maintained in Neural Expansion Medium (49% Neurobasal Meida (ThermoFisher, cat#21103049), 49% Advanced DMEM/F12 (ThermoFisher, cat#12634010) and 2% Neuronal Induction Supplement.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Omni ATAC-seq was performed on wildtype iPSCs and both wildtype and INTS10 heterzygote NPCs (HET2) according to Corces et al 2017. Briefly, 50,000 cells were washed in ATAC-resuspension buffer (RSB) with 0.1% Tween-20 and then lysed by incubated on ice for 3 minutes in RSB with 0.1% NP-40 and 0.1% Tween-20. Lysis was washed out in RSB 0.1% Tween-20 and nuclei was pelleted by centrifugation at 600g/4°C/5 minutes. Nuclei were then incubated in transposition mixture for 30 minutes at 37°C while shaking at 1000rpm. DNA was then purified using Zymo DNA clean and concentrator-5 Kit (cat# D4014). DNA was then amplified for 5 cycles with ATAC index primers and NEBNext Ultra II Q5 Master Mix (NEB #M0544). Additional amplification cycles were then determined by qPCR using 5uL of original amplification with PerfeCTa SYBR Green FastMix Reaction Mixes (Quantabio 95072-012). After additional amplification cycles with remaining 15uL DNA was then purified using Zymo DNA clean and concentrator-5 Kit (cat# D4014) and quantified by QUBIT.
Omni-ATAC-seq (Corces et al. 2017)
|
| |
|
| Library strategy |
ATAC-seq |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
NextSeq 2000 |
| |
|
| Description |
ATAC in INTS10HET2 NPCs
|
| Data processing |
Image analysis: Firecrest (Illumina pipeline 1.9, default parameters)
Base calling: Bustard (Illumina pipeline 1.9, default parameters)
Quality control: FastQC
Adapter trimming: Trim Galore!
Alignment: BWA-MEM
Tag density files: deepTools bamCoverage
Genome_build: GRCh37/hg19
Assembly: hg19
Supplementary files format and content: Supplementary_files_format_and_content: strand-specific bigWig, compatible with UCSC Genome Browser, generated using the deepTools package (bamCoverage function, with RPGC [reads per genome coverage] normalization)
|
| |
|
| Submission date |
Apr 28, 2023 |
| Last update date |
May 03, 2023 |
| Contact name |
Alessandro Gardini |
| E-mail(s) |
agardini@wistar.org
|
| Phone |
2158983755
|
| Organization name |
The Wistar Institute
|
| Lab |
Gardini Lab
|
| Street address |
3601 Spruce St, Room 230
|
| City |
Philadelphia |
| State/province |
PA |
| ZIP/Postal code |
19104 |
| Country |
USA |
| |
|
| Platform ID |
GPL30173 |
| Series (2) |
| GSE230893 |
Control of cell identity and early neuronal fate commitment by the enhancer module of Integrator [ATAC-Seq] |
| GSE230928 |
Control of cell identity and early neuronal fate commitment by the enhancer module of Integrator |
|
| Relations |
| BioSample |
SAMN34424097 |
| SRA |
SRX20140605 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM7246578_NPC-INTS10HET2-ATAC-rep1_mem_srt_noMT_q10_rmdup_S_offset_srt_RD.bw |
246.9 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
