|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on May 02, 2023 |
Title |
NPC, WT, H3K4me1, biol rep1 |
Sample type |
SRA |
|
|
Source name |
NPC
|
Organism |
Homo sapiens |
Characteristics |
cell line: NPC cell type: neuronal progenitor cell differentated from pluripotent stem cells genotype: wt treatment: No treatment chip antibody: H3K4me1(abcam ab8895)
|
Treatment protocol |
Lentiviruses were produced in HEK293T cells by co-transfection 8 ug of pLentiCRISPR v2-INTS10 gRNA3 (Target sequence: TTCTGAGAGCTACGTTTGCT). iPSCs or SH-SY5Y were passaged into a 6-well plate at 30-40 % confluence. When the cells reached 60-70% confluence, 2 ml of virus medium per well (cell medium with 4 ul of lentiviral particles per ml and 8 ug/ml polybrene (Thermo Fisher, cat#TR1003G)) was added to replace old medium. 24 hours after induction, the virus medium was removed and replaced with fresh cell culture medium for another 48 hours. After that, cells were selected with with 0.5 ug/ml of puromycin in fresh medium (InvivoGen, cat#ant-pr-1). 48 hours after selection with puromycin, iPSC colonies were disassociated with Accutase and passed through a 40 uM cell stainer to to generate single cells. Singel cell suspension with 10 μM of ROCK inhibitor and 0.5 ug/ml of puromycin were seeded in Geltrex-coated 10 cm dishes. ROCK inhibitor was removed 24 hours after the seeding. Single cells were cultured in iPSC medium with 0.5 ug/ml of puromycin for the next 2-3 weeks until iPSC colonies appeared. SH-SY5Y cells after selection with puromycin for 48 hours were trypsinized and plated into 10 cm tissue culture dishes. Single cells were maintained in the basal medium supplemented with 0.5 ug/ml of puromycin for the next 2-3 weeks until cell colonies appeared. Individual microcolonies were moved to a 96-well plate for clonal expansion. Clones were screened by PCR initially ( Primers: INTS10-F, 5'- TATACCAGTGGCCTCTTGTC - 3', INTS10-R, 5' - CGTCTTCCTTTATCCATCTGCC - 3') and verified by Western Blot and Sanger sequencing.
|
Growth protocol |
iPSCs were cultured on Geltrex-coated plates and maintained in StemMACS™ iPS-Brew XF (Miltenyi Biotec, cat#130-104-368). NPCs were differentiated from iPSCs using Neural Induction Medium (98% Neurobasal Meida (ThermoFisher, cat#21103049) and 2% Neuronal Induction Supplementd) for 7 days and maintained in Neural Expansion Medium (49% Neurobasal Meida (ThermoFisher, cat#21103049), 49% Advanced DMEM/F12 (ThermoFisher, cat#12634010) and 2% Neuronal Induction Supplement. Neurons were differentiated from NPCs neuronal differentiation medium ( Neurobasal Meida (ThermoFisher Scientific, cat#21103049), B27 (ThermoFisher Scientific,cat#A3353501), GlutaMAX (ThermoFisher Scientific, cat#35050061), nonessential animal acids (ThermoFisher Scientific, cat#11140050), 20 ng/ml brain-derived neurotrophic factor (BDNF) (Peprotech, cat#450-02) and 20 ng/ml glial cell-derived neurotrophic factor (GDNF)(Peprotech, cat#450-10) for 21 days and then mainted in this media. SHSY5Y cells were maintained in the basal medium (45% of Minimum Essential Medium (MEM) (Corning, cat#10009CV), 45% of Nutrient Mixture F-12 Ham (Sigma-Aldrich, Cat#N4888) and 10% of fetal bovine serum (Corning, cat#35010CV)).
|
Extracted molecule |
genomic DNA |
Extraction protocol |
Lysates were clarified from sonicated nuclei (Covaris S220), and protein-DNA complexes were isolated with antibody-conjugated Dynabeads NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs Inc.)
|
|
|
Library strategy |
ChIP-Seq |
Library source |
genomic |
Library selection |
ChIP |
Instrument model |
NextSeq 2000 |
|
|
Description |
H3K4me1ChIP-seq in WT NPCs
|
Data processing |
Image analysis: Firecrest (Illumina pipeline 1.9, default parameters) Base calling: Bustard (Illumina pipeline 1.9, default parameters) Quality control: FastQC Adapter trimming: Trim Galore! Alignment (ChIPseq): BWA-MEM Tag density files: deepTools bamCoverage Genome_build: GRCh37/hg19 Assembly: hg19 Supplementary files format and content: Supplementary_files_format_and_content: strand-specific bigWig, compatible with UCSC Genome Browser, generated using the deepTools package (bamCoverage function, with RPGC [reads per genome coverage] normalization)
|
|
|
Submission date |
Apr 28, 2023 |
Last update date |
May 03, 2023 |
Contact name |
Alessandro Gardini |
E-mail(s) |
agardini@wistar.org
|
Phone |
2158983755
|
Organization name |
The Wistar Institute
|
Lab |
Gardini Lab
|
Street address |
3601 Spruce St, Room 230
|
City |
Philadelphia |
State/province |
PA |
ZIP/Postal code |
19104 |
Country |
USA |
|
|
Platform ID |
GPL30173 |
Series (2) |
GSE230894 |
Control of cell identity and early neuronal fate commitment by the enhancer module of Integrator [ChIP-Seq] |
GSE230928 |
Control of cell identity and early neuronal fate commitment by the enhancer module of Integrator |
|
Relations |
BioSample |
SAMN34425985 |
SRA |
SRX20140850 |
Supplementary file |
Size |
Download |
File type/resource |
GSM7246642_NPC_WT_H3K4me1_ChIP_STAR_aln_to_genome_q10_srt_DS.bw |
165.0 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
|
|
|
|
|