 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on May 02, 2023 |
| Title |
NPC, WT, HiC, biol rep1 |
| Sample type |
SRA |
| |
|
| Source name |
NPC
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: NPC
cell type: neuronal progenitor cell differentated from pluripotent stem cells
genotype: wt
treatment: No treatment
|
| Treatment protocol |
Lentiviruses were produced in HEK293T cells by co-transfection 8 ug of pLentiCRISPR v2-INTS10 gRNA3 (Target sequence: TTCTGAGAGCTACGTTTGCT). iPSCs were passaged into a 6-well plate at 30-40 % confluence. When the cells reached 60-70% confluence, 2 ml of virus medium per well (cell medium with 4 ul of lentiviral particles per ml and 8 ug/ml polybrene (Thermo Fisher, cat#TR1003G)) was added to replace old medium. 24 hours after induction, the virus medium was removed and replaced with fresh cell culture medium for another 48 hours. After that, cells were selected with with 0.5 ug/ml of puromycin in fresh medium (InvivoGen, cat#ant-pr-1). 48 hours after selection with puromycin, iPSC colonies were disassociated with Accutase and passed through a 40 uM cell stainer to to generate single cells. Singel cell suspension with 10 μM of ROCK inhibitor and 0.5 ug/ml of puromycin were seeded in Geltrex-coated 10 cm dishes. ROCK inhibitor was removed 24 hours after the seeding. Single cells were cultured in iPSC medium with 0.5 ug/ml of puromycin for the next 2-3 weeks until iPSC colonies appeared.
|
| Growth protocol |
iPSCs were cultured on Geltrex-coated plates and maintained in StemMACS™ iPS-Brew XF (Miltenyi Biotec, cat#130-104-368). NPCs were differentiated from iPSCs using Neural Induction Medium (98% Neurobasal Meida (ThermoFisher, cat#21103049) and 2% Neuronal Induction Supplementd) for 7 days and maintained in Neural Expansion Medium (49% Neurobasal Meida (ThermoFisher, cat#21103049), 49% Advanced DMEM/F12 (ThermoFisher, cat#12634010) and 2% Neuronal Induction Supplement.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
In situ HiC was performed on wildtype and INTS10 heterzygote NPCs (HET2) using the Arima HiC+ kit (Arima Genomics). Briefly, according to the standard input protocol, 5 million cells were crosslinked then flash-frozen in aliquots of 1 million cells. After quantifying the DNA from 1 million cells, we used two aliquots of cells per condition to meet the amount of DNA (500ng-5ug) required to proceed with the HiC reaction. Digestion and proximity ligation steps were done according to the kit protocol. Proximally ligated DNA underwent quality control checks for ligation efficiency then they were sonicated with the Covaris ME220 sonicator and size selected with DNA purification beads (AMPure XP Beads) to obtain a fragment size distribution of 200-600bp prior to the biotin enrichment step. Finally, libraries were prepared by end repair, dA-tailing, and adaptor ligation using the NEB Next Ultra II DNA Library Prep kit for Illumina, following a protocol tailored for Arima HiC DNA.
NEB Next Ultra II DNA Library Prep kit for Illumina, following a protocol tailored for Arima HiC DNA.
|
| |
|
| Library strategy |
Hi-C |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
NextSeq 2000 |
| |
|
| Description |
HiC in WT NPCs
|
| Data processing |
Image analysis: Firecrest (Illumina pipeline 1.9, default parameters)
Base calling: Bustard (Illumina pipeline 1.9, default parameters)
Quality control: FastQC
Adapter trimming: Trim Galore!
Alignment: HiCPro
Loop files (.arc): FitHiC
Genome_build: GRCh37/hg19
Assembly: hg19
Supplementary files format and content: Supplementary_files_format_and_content: .cool files and .arcs files
|
| |
|
| Submission date |
Apr 28, 2023 |
| Last update date |
May 03, 2023 |
| Contact name |
Alessandro Gardini |
| E-mail(s) |
agardini@wistar.org
|
| Phone |
2158983755
|
| Organization name |
The Wistar Institute
|
| Lab |
Gardini Lab
|
| Street address |
3601 Spruce St, Room 230
|
| City |
Philadelphia |
| State/province |
PA |
| ZIP/Postal code |
19104 |
| Country |
USA |
| |
|
| Platform ID |
GPL30173 |
| Series (2) |
| GSE230914 |
Control of cell identity and early neuronal fate commitment by the enhancer module of Integrator [Hi-C] |
| GSE230928 |
Control of cell identity and early neuronal fate commitment by the enhancer module of Integrator |
|
| Relations |
| BioSample |
SAMN34423910 |
| SRA |
SRX20140636 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM7246729_Juicebox_NPC_WT_HiC_10kb_merged_q0.01_test.arcs.txt.gz |
121.1 Kb |
(ftp)(http) |
TXT |
| GSM7246729_Juicebox_NPC_WT_HiC_40kb_merged_q0.01_test.arcs.txt.gz |
403.5 Kb |
(ftp)(http) |
TXT |
| GSM7246729_NPC_WT_HiC_10000_matrix.cool.gz |
6.0 Mb |
(ftp)(http) |
COOL |
| GSM7246729_NPC_WT_HiC_40000_matrix.cool.gz |
3.6 Mb |
(ftp)(http) |
COOL |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
