|
| Status |
Public on May 02, 2023 |
| Title |
NPC, INTS10HET2, replicate 1, scRNAseq |
| Sample type |
SRA |
| |
|
| Source name |
NPC
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: NPC
cell type: neuronal progenitor cell differentated from pluripotent stem cells
genotype: INTS10HET2
treatment: No treatment
age: 6-8 weeks old
|
| Treatment protocol |
Lentiviruses were produced in HEK293T cells by co-transfection 8 ug of pLentiCRISPR v2-INTS10 gRNA3 (Target sequence: TTCTGAGAGCTACGTTTGCT). iPSCs or SH-SY5Y were passaged into a 6-well plate at 30-40 % confluence. When the cells reached 60-70% confluence, 2 ml of virus medium per well (cell medium with 4 ul of lentiviral particles per ml and 8 ug/ml polybrene (Thermo Fisher, cat#TR1003G)) was added to replace old medium. 24 hours after induction, the virus medium was removed and replaced with fresh cell culture medium for another 48 hours. After that, cells were selected with with 0.5 ug/ml of puromycin in fresh medium (InvivoGen, cat#ant-pr-1). 48 hours after selection with puromycin, iPSC colonies were disassociated with Accutase and passed through a 40 uM cell stainer to to generate single cells. Singel cell suspension with 10 μM of ROCK inhibitor and 0.5 ug/ml of puromycin were seeded in Geltrex-coated 10 cm dishes. ROCK inhibitor was removed 24 hours after the seeding. Single cells were cultured in iPSC medium with 0.5 ug/ml of puromycin for the next 2-3 weeks until iPSC colonies appeared.
|
| Growth protocol |
NPCs were differentiated from iPSCs using Neural Induction Medium (98% Neurobasal Meida (ThermoFisher, cat#21103049) and 2% Neuronal Induction Supplementd) for 7 days and maintained in Neural Expansion Medium (49% Neurobasal Meida (ThermoFisher, cat#21103049), 49% Advanced DMEM/F12 (ThermoFisher, cat#12634010) and 2% Neuronal Induction Supplement.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
To harvest cells for single-cell RNAseq, cultured NPCs were incubated with Accutase (A6964) for 5 min at 37 ℃. An equal volume of DPBS was added to each well to collect the cells. Cell suspension was strained through 40um Cell Strainer (XXXX) twice. The single cell suspension was centrifuged at 400 x g for 5 mins and resuspended in DPBS for counting. Cell viability was examined by 0.4% Trypan blue. Single cell suspension with 98% viability containing 15, 000 viable cells (aiming for recovery of 10, 000 cells) were processed using the Chromium Next GEM Single Cell 3' Kit v3.1 to generate cDNA libraries following manufacture's instructions. The quality of cDNA and libraries were assessed by the Agilent 2100 Bioanalyzer System ( or TapeStation). Libraries were sequenced on IllumniaXXXXX.
Chromium Next GEM Single Cell 3' Kit v3.1
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic single cell |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
10x Genomics
|
| Data processing |
Image analysis: Firecrest (Illumina pipeline 1.9, default parameters)
Base calling: Cell Ranger mkfastq pipeline v6.1.1 ( 10X Genomics)
Count matrix: Cell Ranger count pipeline v6.1.1 (10X Genomics)
Normalization: Cell Ranger aggr pipeline
Assembly: hg19
Supplementary files format and content: Tab-separated values files and matrix files
|
| |
|
| Submission date |
Apr 28, 2023 |
| Last update date |
May 03, 2023 |
| Contact name |
Alessandro Gardini |
| E-mail(s) |
agardini@wistar.org
|
| Phone |
2158983755
|
| Organization name |
The Wistar Institute
|
| Lab |
Gardini Lab
|
| Street address |
3601 Spruce St, Room 230
|
| City |
Philadelphia |
| State/province |
PA |
| ZIP/Postal code |
19104 |
| Country |
USA |
| |
|
| Platform ID |
GPL18573 |
| Series (2) |
| GSE230922 |
Control of cell identity and early neuronal fate commitment by the enhancer module of Integrator [scRNA-Seq] |
| GSE230928 |
Control of cell identity and early neuronal fate commitment by the enhancer module of Integrator |
|
| Relations |
| BioSample |
SAMN34425520 |
| SRA |
SRX20140827 |
