|
Status |
Public on Dec 05, 2011 |
Title |
Bisulfite-Seq analysis of RRBS1085 derived from human Mobilized CD34 cells; RRBS1085 |
Sample type |
SRA |
|
|
Source name |
flow sorted CD34+ cells from cord blood; RRBS1085
|
Organism |
Homo sapiens |
Characteristics |
sample alias: RO 01520 sample common name: CD34 Primary Cells molecule: genomic DNA disease: None biomaterial_provider: FHCRC HEIMFELD biomaterial_type: Primary Cell cell_type: CD34 Primary Cells markers: CD34+ donor_id: RO 01520 donor_age: 50 years donor_health_status: NA donor_sex: Female donor_ethnicity: NA passage_if_expanded: NA bisulfite_conversion_protocol: 2x5hrs Epitect Kit dna_preparation_initial_dna_qnty: 20 ng extraction_protocol_sonication_cycles: NA dna_preparation_adaptor_ligation_protocol: T4 Ligase (2,000U/ul) 16C o/n dna_preparation_adaptor_sequence: 5' P-GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG and 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT library_generation_pcr_r_primer_sequence: 5' CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT dna_preparation_post-ligation_fragment_size_selection: 120-370 bisulfite_conversion_percent: >99% extraction_protocol: Standard Protocol (Smith et al., Methods 48, 226-232) library_generation_pcr_primer_conc: 25uM dna_preparation_fragment_size_range: 38-280 experiment_type: DNA Methylation library_generation_pcr_thermocycling_program: Smith et al., Methods 48, 226-232 library_generation_pcr_product_isolation_protocol: Gel size selection library_generation_pcr_f_primer_sequence: 5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT library_generation_pcr_template_conc: NA library_generation_pcr_polymerase_type: Pfu Turbo Cx hot start library_generation_pcr_number_cycles: 15 extraction_protocol_type_of_sonicator: NA
|
Extracted molecule |
genomic DNA |
Extraction protocol |
Library construction protocol: Smith et al., Methods 48, 226-232
|
|
|
Library strategy |
Bisulfite-Seq |
Library source |
genomic |
Library selection |
Reduced Representation |
Instrument model |
Illumina Genome Analyzer IIx |
|
|
Description |
sample_term_id: CL_0000837 assay_term_id: OBI_0001862 nucleic_acid_term_id: SO_0000352 Design description: RRBS REMC Sequencing on Illumina Library name: RRBS1085 EDACC Genboree Experiment Page: http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FBroad%2FEXPERIMENT%2FEDACC.7487 EDACC Genboree Sample Page: http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FUniversity%20of%20Washington%2FSAMPLE%2FEDACC.2417 **************** For data usage terms and conditions, please refer to: http://www.drugabuse.gov/funding/funding-opportunities/nih-common-fund/epigenomics-data-access-policies ****************
|
Data processing |
**********************************************************************
ANALYSIS FILE NAME: GSM772731_BI.Mobilized_CD34_Primary_Cells.RRBS.RO_01520.wig ANALYSIS CENTER: EDACC ANALYSIS ALIAS: RRBS1085.hg19.level.2.release.4 ANALYSIS TITLE: Methylation Proportion Graphs of Mobilized CD34 Primary Cells RRBS Data ANALYSIS DESCRIPTION: Illumina RRBS read mappings from Mobilized CD34 Primary Cells, Donor RO 01520 were processed into graphs of methylation proportions. Methylation proportions were calculated as (methylated calls / (methylated calls + unmethylated calls)) for all CpGs covered by at least 4 reads. ANALYSIS TYPE: ABUNDANCE_MEASUREMENT EDACC Genboree Analysis Page: http://genboree.org/java-bin/project.jsp?projectName=XML%20Submissions%2FEDACC%2FANALYSIS%2FEDACC.8336 DATA_ANALYSIS_LEVEL: 2 EXPERIMENT_TYPE: Reduced Representation Bisulfite-Seq GENOME_ASSEMBLY: NCBI Build GRCh37/UCSC Build hg19 MspI restriction fragments 40-220bp SOFTWARE: In house programs and scripts SOFTWARE_VERSION: NA READ_EXTENSION: 0bp TREATMENT_OF_IDENTICAL_ALIGNMENTS_OF_MULTIPLE_READS: None GENOMIC_WINDOW: 2bp containing CpGs TREATMENT_OF_REGIONS_PRONE_TO_MULTIPLE_ALIGNMENTS: None RELEASE_NUMBER: Human Epigenome Atlas 4 BROWSER_TRACK_NAME: MCD34 RRBS 20 85 BROWSER_TRACK_DESCRIPTION: BI Mobilized CD34 Primary Cells RRBS Donor RO 01520 Library RRBS1085 EA Release 4
QUALITY SCORES: NUMBER_OF_MAPPED_READS: 21,355,945 NUMBER_OF_RRBS_EXPERIMENTS_SCORED_IN_THIS_RELEASE: 21 BISULFITE_CONVERSION_PERCENTAGE_BASED_ON_MAPPINGS: 99.68 BISULFITE_CONVERSION_PERCENTAGE_BASED_ON_MAPPINGS_PERCENTILE: 71 MAXIMUM_REPLICATE_CORRELATION: 0.88
**********************************************************************
|
|
|
Submission date |
Aug 03, 2011 |
Last update date |
May 15, 2019 |
Contact name |
BROAD INSTITUTE |
E-mail(s) |
rharris1@bcm.tmc.edu
|
Organization name |
Broad Institute
|
Street address |
-
|
City |
Cambridge |
State/province |
MA |
ZIP/Postal code |
02142 |
Country |
USA |
|
|
Platform ID |
GPL10999 |
Series (1) |
GSE17312 |
BI Human Reference Epigenome Mapping Project |
|
Relations |
SRA |
SRX088646 |
BioSample |
SAMN00113439 |
Named Annotation |
GSM772731_BI.Mobilized_CD34_Primary_Cells.RRBS.RO_01520.wig.gz |