|
| Status |
Public on Jun 27, 2024 |
| Title |
hpEIN2[24_1]_12 |
| Sample type |
SRA |
| |
|
| Source name |
hpEIN2[{delta}24nt-1]
|
| Organism |
Arabidopsis thaliana |
| Characteristics |
tissue: whole seedling
ecotype: Col
time: 4 day in dark
|
| Growth protocol |
hpEIN2 T2 seedlings were grown on kaanmycin sterilized wild-type and T2 transgenic seeds were grown on ½ MS media (without organics) supplemented with 5mg/L 1-aminocyclopropane-1-carboxylic acid (ACC) and kanamycin (excluding WT lines). The plates were sealed tightly with parafilm and exposed under light for 10 h at 22° to promote germination, and then incubated in dark for 4 days.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA was extracted using trizol
NEXTFLEX Small RNA v3 library preperation with bead size selection
libraries sequenced on a Novaseq, 100 cycle
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina NovaSeq 6000 |
| |
|
| Data processing |
Reads were trimmed using cut adapt -a TGGAATTCTCGGGTGCCAAGG --minimum-length=23
Reads were further timmed using cut adapt -u 4 -u -4
Trimmed reads were mapped to the Arabidopsis genome, EIN2 cDNA , hpEIN2 sequence including 35s promoter and sense strand of the different asymmetric bulge stems
Reads were mapped using Bowtie 1.3.1 with options -v 0 -a --best --strata -l 18
awk commands were used to only retain reads which mapped to ein2 cDNA, hpRNA or stem sense strand sequences with only unique reads retained for downstream analysis
Assembly: TAIR10_chr_all.fas
Supplementary files format and content: raw files are in .fastq.gz format
Supplementary files format and content: processed files are unique reads mapped to the EIN2 sequence in a .bed format. Rows are 1 = mapping to EIN2 or asymmetric bulge sense strands; 2 = Start; 3= End; 4 = read name; 5 = quality; 6 = strand; 7 = sRNA size
|
| |
|
| Submission date |
Sep 14, 2023 |
| Last update date |
Jun 27, 2024 |
| Contact name |
Ian K Greaves |
| E-mail(s) |
ian.greaves@csiro.au
|
| Phone |
61 6246 4828
|
| Organization name |
csiro
|
| Street address |
clunies ross street
|
| City |
Acton |
| State/province |
act |
| ZIP/Postal code |
2601 |
| Country |
Australia |
| |
|
| Platform ID |
GPL26208 |
| Series (2) |
| GSE243296 |
Asymmetric bulges within hairpin RNA transgenes influence small RNA size, secondary siRNA production and viral defence II |
| GSE243297 |
Asymmetric bulges within hairpin RNA transgenes influence small RNA size, secondary siRNA production and viral defence |
|
| Relations |
| BioSample |
SAMN37403485 |
| SRA |
SRX21783272 |
