 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Feb 01, 2024 |
| Title |
Germinating seed, 24h stratification, rep1, csRNA-seq |
| Sample type |
SRA |
| |
|
| Source name |
Seeds
|
| Organism |
Arabidopsis thaliana |
| Characteristics |
tissue: Seeds
genotype: Col-0
treatment: Germinating seed, 24h stratification
genotype: Col-0
molecule type: Capped-small enriched RNA
|
| Growth protocol |
Arabidopsis thaliana seeds were surface-sterilized using the gas product of 100 mL of bleach mixed with 3 mL hydrochloric acid for 1 h, followed by stratification in water in the dark at 4 ˚C. Seeds were grown in 50 mL liquid ½ MS in 125 mL Erlenmeyer flasks, shaking at 180 RPM, in continuous light at 22 ˚C.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
50 mg of sample (or 25 mg for dry seeds) was flash-frozen in liquid nitrogen and ground to a powder with a mortar and pestle. 1.5 mL of extraction buffer (EB; 100 mM Tris-HCl pH 9.5, 150 mM NaCl, 5 mM EDTA pH 8, 1% sarkosyl) was prepared per sample, and 7.5 µL beta-mercaptoethanol was added to each EB aliquot and briefly vortexed. After addition of the EB to the frozen ground tissue powder, the homogenate was mixed vigorously and left on ice for 10 min, with intermittent vortexing. This was followed by a 10 min max-speed centrifugation at 4 ˚C in a benchtop centrifuge. 1 mL of supernatant (avoiding the starchy upper-most layer) was transferred to a new tube and mixed with 1 mL chloroform. Following a 15 s vortexing step, the mixture was centrifuged as before and 900 µL of the upper phase transferred to a new tube. To this was added 90 µL 3 M NaOAc and 1 mL Tris-buffered phenol-chloroform, followed by vortexing for 15 s and another centrifugation as before. As much clear supernatant as possible was moved to a new tube and gently mixed by inversion with an equal volume isopropanol and incubated at 4 ˚C for 1 h. The precipitated RNA was pelleted by a 20 min max-speed centrifugation at 4 ˚C. The supernatant was discarded and the pellet washed with 800 µL ice-cold 75% ethanol, followed by a 5 min centrifugation at 7,500 x g at 4 ˚C. The supernatant was discarded, further removed with a pipette after pulse-spinning, and left inverted to dry for 2 min. The pellet was dissolved in 100 µL nuclease-free water, to which 10 µL DNaseI buffer (ThermoFisher Scientific), 5 µL DNaseI (ThermoFisher Scientific), and 1 µL RiboLock (ThermoFisher Scientific) was added and left to incubate at 37 ˚C for 30 min. The resulting DNA-free RNA was isolated using a modified RNA purification protocol. Briefly, 240 µL nuclease-free water was added to the DNaseI reaction alongside 40 µL solubilization buffer (200 mM Tris-HCl pH 7.5, 10 mM EDTA pH 8, 5% SDS) and vortexed. Afterwards 40 µL 3 M NaOAc and 800 µL Tris-buffered phenol-chloroform was added and again vortexed for 15 s, followed by a max-speed centrifugation for 5 min at 4 ˚C. The supernatant was transferred to a new tube containing 800 µL chloroform and vortexed for 15 s, followed by another centrifugation as before. The supernatant was again transferred to a new tube, this time to one containing 1 mL ice-cold ethanol, gently mixed by inversion, and left at -80 ˚C overnight. The following day the tube was centrifuged as before for 20 min. The supernatant was discarded and the pellet was washed with 800 µL 75% ethanol, followed by a 5 min centrifugation at 7,500 x g at 4 ˚C. The supernatant was removed, and again removed using a pipette after pulse spinning. After leaving the tubes to dry inverted for 2 min, the pellet was dissolved in 27 µL nuclease-free water (of which 1.5 µL was used for quantification with a NanoDrop (ThermoFisher Scientific)) and stored at -80 ˚C. RNA integrity was assessed by running 1 µg RNA in a denaturing RNA gel and 100 ng RNA with a Bioanalyzer RNA analysis chip (Agilent). 15 µg of RNA in 15 µL TET buffer (10 mM Tris-HCl pH 7.5, 0.1 mM EDTA, 0.05% Tween-20) was mixed with 15 µL FLB solution (95% formamide, 0.005 % bromophenol blue, 0.005% xylene cyanol, 1 mM EDTA) and incubated at 75 ˚C for 5 min before cooling on ice. This was then run at 200 V for 40 min in a 6 mL 15% urea gel (2.88 g urea, 3 mL 30% acrylamide, 600 µL 10X TBE, 60 µL 10% APS, 2.4 µL TEMED, up to 6 mL with water) which had been pre-run for 30 min in 1X TBE. The gel was incubated in 0.5 µg/mL ethidium bromide (in 1X TBE) for 2 min in the dark with gentle rocking. Using a scalpel and a UV imager, the gel was cut from beneath the lowest visible band to the one-third point from the bottom marker to the top marker for each lane. The gel piece was placed in a 0.5 mL LoBind tube (Eppendorf) with three holes poked out at the bottom using 22 gauge hypodermic needles (Terumo), which itself was placed in a 2 mL LoBind tube (Eppendorf) and centrifuged at maximum speed in a benchtop centrifuge for 2 min. To the resulting slurry 500 µL GEB solution (0.4 M NaOAc pH 5.5, 10 mM Tris pH 7.5, 1 mM EDTA, 0.05% Tween-20) was added and incubated for 2 h in the dark with gentle shaking. This was then transferred to a PVDF 0.45 µm filter column (Merck) held in a 2 mL LoBind tube (Eppendorf) and centrifuged for 2 min at 1000 x g. The column was removed, 1.5 µL GlycoBlue (ThermoFisher Scientific) and 1.5 mL ice-cold ethanol added, and following mixing by inversion the tube was incubated overnight at -80 ˚C. The following morning the RNA was centrifuged at maximum speed in a cooled benchtop centrifuge (4 ˚C) for 30 min. The supernatant was removed and the pellet washed with 1 mL ice-cold 75% ethanol, followed by a final centrifugation at 7,500 x g for 5 min. The pellet was air-dried for 2 min and resuspended in 6 µL nuclease-free water containing 0.05% Tween-20.
Small RNA samples were incubated at 75 ˚C for 2 min before cooling on ice. For the sRNA-seq, 0.6 µL of the sample was transferred to a new tube containing 1 µL nuclease-free water containing 0.05% Tween-20 and set aside. 14 µL Terminator mastermix (10.75 µL nuclease-free water containing 0.05% Tween-20, 2 µL Terminator Buffer A (Lucigen), 0.25 µL RiboLock (ThermoFisher Scientific), 1 µL Ter51020 (Lucigen)) was added to the sample and incubated for 1 h at 30 ˚C. 30 µL CIP mastermix (24 µL nuclease-free water containing 0.05% Tween-20, 5 µL CutSmart buffer (New England Biolabs), 1 µL CIP (New England Biolabs)) was then mixed in and incubated for 45 min at 37 ˚C. Following this, 50 µL RNAClean XP beads (Beckman Coulter) were added and the solution mixed. 100 µL isopropanol was then added, the tube mixed, and incubated on ice for 10 min. The tube was placed in a magnetic rack for 5 min. The supernatant was removed and the beads were washed twice using 200 µL 80% ethanol containing 0.05% Tween-20. The beads were then air-dried and resuspended in 25 µL nuclease-free water containing 0.05% Tween-20. The tube was incubated at 75 ˚C for 3 min before cooling on ice. 25 µL CIP mastermix (18.5 µL nuclease-free water containing 0.05% Tween-20, 5 µL CutSmart buffer [New England Biolabs], 0.5 µL RiboLock (ThermoFisher Scientific), 1 µL CIP (New England Biolabs)) was added, the tube mixed, and the reaction incubated at 37 ˚C for 45 min. An additional 100 µL nuclease-free water containing 0.05% Tween-20 was added and the tube was placed in a magnetic rack for 5 min. The supernatant was transferred to a new 1.5 mL microcentrifuge tube. 500 µL TRIzol solution (Merck) was added and the tube was vortexed. 140 µL chloroform was added and again vortexed. The tube was centrifuged for 10 min in a benchtop centrifuge. The supernatant was transferred to a new 1.5 mL microcentrifuge tube, to which was added 1/10th volume 3 M NaOAc and 0.5 µL GlycoBlue (ThermoFisher Scientific) and vortexed. An equal volume of isopropanol was added and mixed by inversion, and left to incubate on ice for 20 min. The tube was centrifuged at max speed for 30 in in a cooled benchtop centrifuge (4 ˚C). The supernatant was discarded and the pellet washed with 400 µL 75% ethanol. A small volume containing the pellet was transferred to a PCR tube and spun down before discarding the ethanol wash and leaving to air-dry. The pellet was then dissolved in 3 µL nuclease-free water containing 0.05% Tween-20. This and the previously set aside sample for the sRNA-seq were incubated at 75 ˚C for 90 s before cooling on ice. To each were added 5 µL decapping mastermix (0.8 µL T4 RNA Ligase buffer (New England Biolabs), 3 µL PEG 8000 (New England Biolabs), 0.3 µL RiboLock (ThermoFisher Scientific), 1 µL RppH (New England Biolabs)) and incubated for 1 h at 37 ˚C after thorough mixing. The samples were then cooled on ice. sRNA-seq and csRNA-seq libraries were then prepared using the NEBNext Small RNA library kit (New England Biolabs) following the manufacturers protocol.
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
S24_1_csRNA
tss.csRNAseq.bed
counts.cpm.csRNAseq.tsv
counts.raw.csRNAseq.tsv
S24.csRNAseq.plus.bw
S24.csRNAseq.minus.bw
|
| Data processing |
*library strategy: Capped-small RNA sequencing (csRNA-seq)
Reads were trimmed for the csRNA-seq and sRNA-seq using HOMER v4.11.1 with the following command: homerTools trim -3 AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -mis 2 -minMatchLength 4 -min 20. Trimmed reads for all samples were mapped to the TAIR10 genome sequence using STAR v2.7.9a with the following options: –outSAMstrandField intronMotif –outMultimapperOrder Random –outSAMmultNmax 1 –outFilterMultimapNmax 10000 –limitOutSAMoneReadBytes 10000000. The resulting csRNA-seq and sRNA-seq BAM files were filtered using samtools v1.14 and custom AWK scripts to exclude reads with more than 1 mismatch, a MAPQ score of less than 10, gaps, soft-clipping or a length outside of the range of 20-70 nucleotides. HOMER format tag directories were created using the makeTagDirectory program with the options -genome tair10 -checkGC.
The findcsRNATSS.pl program from HOMER v4.11.1 was used to identify TSS peaks from the csRNA-seq samples with the following options: -includeSingleExons -genome tair10 -ntagThreshold 1 -noFilterRNA -minDistDiff 0.01 -L 1.5. The corresponding sRNA-seq and total RNA-seq BAM files for each sample were also included in the command via the -i and -rna options, respectively. Only TSS peaks present in both replicates were kept, and a final merged TSS peak set was created using the mergePeaks program from HOMER78. TSSs were annotated as belonging to an existing Araport11 transcript30 if they were present either within the 5′ region of the transcript or 500 bp upstream to 200 bp downstream of a TSS, or were within the first 25% of the transcript length using R v4.3.1 and base Bioconductor packages.
TMM-normalized counts per million (CPM) from all csRNA-seq samples were obtained by first reading the counts into R v4.3.1, then normalizing them using the calcNormFactors and cpm functions from the edgeR package.
Coverage tracks in bedGraph format were generated from the csRNA-seq and sRNA-seq tag directories using the makeUCSCfile program from HOMER v4.11.1. The csRNA-seq files were further converted to bigWig using R v4.3.1 with the edgeR package to TMM-normalize the signal density.
Assembly: TAIR10
Supplementary files format and content: Transcription start site (TSS) tab-separated quantification tables contain a column of TSS names and columns of counts for each csRNA-seq sample.
Supplementary files format and content: csRNA-seq read pileups per strandare provided in bigWig format.
Supplementary files format and content: sRNA-seq (input) read pileups per strand are provided in bedGraph format.
|
| |
|
| Submission date |
Dec 15, 2023 |
| Last update date |
Feb 01, 2024 |
| Contact name |
Julia I. Qüesta |
| E-mail(s) |
julia.questa@cragenomica.es
|
| Organization name |
Centre for Research in Agricultural Genomics
|
| Street address |
Carrer de la Vall Moronta
|
| City |
Cerdanyola del Vallès |
| State/province |
Barcelona |
| ZIP/Postal code |
08193 |
| Country |
Spain |
| |
|
| Platform ID |
GPL19580 |
| Series (2) |
| GSE250329 |
Interplay between coding and non-coding regulation drives the Arabidopsis seed-to-seedling transition (csRNA-seq) |
| GSE250331 |
Interplay between coding and non-coding regulation drives the Arabidopsis seed-to-seedling transition. |
|
| Relations |
| BioSample |
SAMN38859165 |
| SRA |
SRX22906374 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM7977698_S24.csRNAseq.minus.bw |
1.5 Mb |
(ftp)(http) |
BW |
| GSM7977698_S24.csRNAseq.plus.bw |
1.5 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
|
|
|
|
 |
