GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM8108013

Query DataSets for GSM8108013

Status

Public on Apr 17, 2024

Title

318_whole_Male_HZ_E2

Sample type

SRA

Source name

whole

Organism

Gallus gallus

Characteristics

tissue: whole
developmental stage: E2
hh stage: 11
breed: G2 Outcross
genotype: HZ
Sex: Male

Extracted molecule

polyA RNA

Extraction protocol

A total of 72 samples from E2, E3, and E5 embryos were used for the generation of RNA sequencing libraries. We extracted total RNA from whole embryos or dissected tissues using the AllPrep DNA/RNA/miRNA Universal Kit (Qiagen), following the manufacturer's protocols. The RNA quality was assessed using the Fragment Analyzer system (Agilent), and all RNA quality numbers (RQNs) were equal to 10, indicating a lack of degradation.
The RNA-seq libraries were prepared from 400 ng of RNA per sample using the NEBNext Ultra II RNA Library Prep Kit for Illumina sequencing was performed on an Illumina NextSeq 2000 system, using NextSeq 2000 P3 Reagents (100 Cycles), with samples multiplexed in two sets of 36. Additionally, we generated small RNA libraries using RNA derived from the same E5 male samples (i.e., those that were also used for the generation of RNA sequencing libraries). This included the generation of small RNA libraries for RNA derived from ZZ (2 replicates), ZKOZ (3 replicates), and ZKOZKO (3 replicates) for each tissue type (head, body, heart), respectively.
The RNA-seq libraries were prepared from 400 ng of RNA per sample using the NEBNext Ultra II RNA Library Prep Kit for Illumina sequencing was performed on an Illumina NextSeq 2000 system, using NextSeq 2000 P3 Reagents (100 Cycles), with samples multiplexed in two sets of 36. short RNA Seq libraries were prepared using the NEBNext Small RNA Library Prep Set for Illumina and were sequenced on an Illumina NextSeq 550 system using NextSeq 500/550 High Output Kit v2.5 (75 Cycles), with samples multiplexed in two sets of 12.

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

NextSeq 2000

Description

longRNA-Seq

Data processing

Raw reads from each library were aligned to the reference genome using STAR aligner v. 2.7.2b
The alignment process involved generating STAR indices, aligning reads to the reference genome in an annotation-aware manner, and quantifying the number of reads mapped to each gene using the --quantMode GeneCounts option in STAR
The resulting gene count matrices, along with a metadata file containing sample information and the GTF file, were used to create a RangedSummarizedExperiment object
This object was imported into DESeq2 v. 1.24.0 (ref. 47) for downstream analysis.
Raw short RNA-sequencing data were preprocessed using a custom Bash script. Adapter sequences were trimmed and reads were size-selected using Cutadapt version 4.4. The parameters set a maximum error rate of 0.25, targeted the adapter sequence “AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC” with a minimum overlap of 6 nucleotides, and allowed no indels, while selecting for read lengths between 19 and 26 nucleotides. After trimming and size selection, the reads were aligned to the chicken reference genome using STAR following the ENCODE miRNA-seq pipeline49 (www.encodeproject.org/microrna/microrna-seq-encode4/) (May 2017). This alignment process included mapping to the microRNA subset of the chicken GTF gene annotation and quantifying the number of aligned reads in STAR
Assembly: bGalGal1.mat.broiler.GRCg7b; GCA_016699485.1
Supplementary files format and content: DeSeq2 Object containing complete metadata and raw read counts for each gene.
Supplementary files format and content: DeSeq2 Object containing complete metadata and raw read counts for each microRNA..

Submission date

Feb 25, 2024

Last update date

Apr 17, 2024

Contact name

Amir Fallahshahroudi

E-mail(s)

amirshahroudi@gmail.com

Phone

0763043306

Organization name

Uppsala University