|
Status |
Public on Apr 14, 2024 |
Title |
MG1655 WT3 |
Sample type |
SRA |
|
|
Source name |
bacterial cell
|
Organism |
Escherichia coli str. K-12 substr. MG1655 |
Characteristics |
strain: MG1655 cell type: bacterial cell genotype: Wildtype treatment: pH 4.4
|
Treatment protocol |
Once OD600 = 0.5 was reached, 5M HCl was added to the cultures to adjust the pH to 5.8. After 15, 5M HCl was added again to adjust the pH to 4.4 and cells were incubated for another 15 min.
|
Growth protocol |
Cells were inoculated to a starting OD600 of 0.05 from overnight cultures and aerobically grown to exponential phase in 200 ml of unbuffered LB media (pH 7.6) in 1 liter glas flasks.
|
Extracted molecule |
total RNA |
Extraction protocol |
RNA was harvested using the miRNeasy Mini Kit (QIAGEN) in combination with the RNase-Free DNase Set (QIAGEN) following manufacturer's protocols. Ribosomal RNA depletion was performed using the NEBNext rRNA Depletion Kit for bacteria (NEB) following manufacturer's protocols. Integrity of RNA samples was evaluated by using the RNA 6000 Nano Kit (Agilent). cDNA libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB) following manufacturer's protocols. cDNA library quality was assessed by using a High Sensitivity DNA Kit (Agilent).
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
NextSeq 1000 |
|
|
Data processing |
CLC Genomics Workbench v20.0.4 Adapter sequence "AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC" was trimmed using the 'trim-reads' command The trimmed reads were checked for quality and mapped to the E. coli reference genome using the following settings: Mismatch cost = 2, Insertion cost = 3, Deletion cost = 3, Length fraction = 0.8, Similarity fraction = 0.8, Global alignment = Yes, Strand specific = Reverse, Maximum number of hits for a read = 1. Reads mapping in CDS were counted, normalized (rpkm), and transformed (log2). Genes with rpkm values >5 in at least one replicate were considered for analysis.Differential expression was tested using the built in tool corresponding to edgeR in exact mode with tagwise dispersions. Genes with a fold-change of > 2.0 and a FDR adjusted p-value < 0.01 were considered to be differentially expressed. Assembly: NC_000913.3, CP009273.1 Supplementary files format and content: Excel file containing rpkm values and edgeR (exact mode) analysis
|
|
|
Submission date |
Feb 28, 2024 |
Last update date |
Apr 14, 2024 |
Contact name |
Kilian Schumacher |
E-mail(s) |
kilian-schumacher@gmx.de
|
Organization name |
LMU Munich
|
Lab |
AG K.Jung
|
Street address |
Großhaderner Straße 2-4
|
City |
Martinsired |
ZIP/Postal code |
82152 |
Country |
Germany |
|
|
Platform ID |
GPL32899 |
Series (1) |
GSE260455 |
Motility-activating mutations upstream of flhDC reduce acid shock survival of Escherichia coli |
|
Relations |
BioSample |
SAMN40188373 |
SRA |
SRX23778921 |