 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 25, 2024 |
| Title |
NPC_p3 ,shINTS10, Biol rep 2 |
| Sample type |
SRA |
| |
|
| Source name |
NPC_p3
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: NPC_p3
cell type: neuronal progenitor cell differentated from pluripotent stem cells
genotype: INTS10-KD
treatment: shINTS10
|
| Treatment protocol |
Lentiviruses were produced in HEK293T cells by co-transfection 8 ug of pLentiCRISPR v2-INTS10 gRNA3 (Target sequence: TTCTGAGAGCTACGTTTGCT). iPSCs or SH-SY5Y were passaged into a 6-well plate at 30-40 % confluence. When the cells reached 60-70% confluence, 2 ml of virus medium per well (cell medium with 4 ul of lentiviral particles per ml and 8 ug/ml polybrene (Thermo Fisher, cat#TR1003G)) was added to replace old medium. 24 hours after induction, the virus medium was removed and replaced with fresh cell culture medium for another 48 hours. After that, cells were selected with with 0.5 ug/ml of puromycin in fresh medium (InvivoGen, cat#ant-pr-1). 48 hours after selection with puromycin, iPSC colonies were disassociated with Accutase and passed through a 40 uM cell stainer to to generate single cells. Singel cell suspension with 10 μM of ROCK inhibitor and 0.5 ug/ml of puromycin were seeded in Geltrex-coated 10 cm dishes. ROCK inhibitor was removed 24 hours after the seeding. Single cells were cultured in iPSC medium with 0.5 ug/ml of puromycin for the next 2-3 weeks until iPSC colonies appeared. ReN and SH-SY5Y cells after selection with puromycin for 48 hours were trypsinized and plated into 10 cm tissue culture dishes. Single cells were maintained in the basal medium supplemented with 0.5 ug/ml of puromycin for the next 2-3 weeks until cell colonies appeared. Individual microcolonies were moved to a 96-well plate for clonal expansion. Clones were screened by PCR initially ( Primers: INTS10-F, 5'- TATACCAGTGGCCTCTTGTC - 3', INTS10-R, 5' - CGTCTTCCTTTATCCATCTGCC - 3') and verified by Western Blot and Sanger sequencing.
|
| Growth protocol |
iPSCs were cultured on Geltrex-coated plates and maintained in StemMACS™ iPS-Brew XF (Miltenyi Biotec, cat#130-104-368). NPCs were differentiated from iPSCs using Neural Induction Medium (98% Neurobasal Meida (ThermoFisher, cat#21103049) and 2% Neuronal Induction Supplementd) for 7 days and maintained in Neural Expansion Medium (49% Neurobasal Meida (ThermoFisher, cat#21103049), 49% Advanced DMEM/F12 (ThermoFisher, cat#12634010) and 2% Neuronal Induction Supplement. Neurons were differentiated from NPCs neuronal differentiation medium ( Neurobasal Meida (ThermoFisher Scientific, cat#21103049), B27 (ThermoFisher Scientific,cat#A3353501), GlutaMAX (ThermoFisher Scientific, cat#35050061), nonessential animal acids (ThermoFisher Scientific, cat#11140050), 20 ng/ml brain-derived neurotrophic factor (BDNF) (Peprotech, cat#450-02) and 20 ng/ml glial cell-derived neurotrophic factor (GDNF)(Peprotech, cat#450-10) for 21 days and then mainted in this media. SHSY5Y cells were maintained in the basal medium (45% of Minimum Essential Medium (MEM) (Corning, cat#10009CV), 45% of Nutrient Mixture F-12 Ham (Sigma-Aldrich, Cat#N4888) and 10% of fetal bovine serum (Corning, cat#35010CV)). ReNcells were maintained in ReNcell proliferation medium (5 ml of 100X Glutmax, 10 ml of B27, 1 ml of Heparin (1 mg/ml) and 484 ml of DMEM/F12) that supplemented with bFGF ( 20ng/ml) and EGF (20ng/ml). To start the differentiation, ReN cells were plated in Laminin-coated 6-well plates with ReN proliferation medium at 30-40% confluency (Day 0). On the next day (Day 1), remove the medium and feed the cells with fresh ReN differentiation medium (without bFGF and EGF). Cells were fed with fresh ReN differentiation medium every 2-3 days.
|
| Extracted molecule |
polyA RNA |
| Extraction protocol |
RNA was extracted using the Zymo RNA Miniprep kitand then used to make sequencing libraries.
QuantSeq 3' - mRNA Seq Library Prep Kit for Illumina (Lexogen)
QuantSeq 3' - mRNA Seq
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
NextSeq 2000 |
| |
|
| Description |
3' - mRNA
|
| Data processing |
Image analysis: Firecrest (Illumina pipeline 1.9, default parameters)
base calling: Bustard (Illumina pipeline 1.9, default parameters)
Quality Control: FastQC
Adapter Trimming: TRIM-GALORE
alignment: STAR
tag density files: deepTools package was used to generate BigWiggle files
gene counts: FeatureCounts (Liao et al., 2014)
Assembly: Genome_build: hg19
Supplementary files format and content: Supplementary_files_format_and_content: strand specific bigWig, compatible with UCSC Genome Browser, were generated using the deepTools package (bamCoverage function, with RPGC [reads per genome coverage] normalization). Tab delimited gene count files were generated with FeatureCounts.
|
| |
|
| Submission date |
Jun 24, 2024 |
| Last update date |
Jun 25, 2024 |
| Contact name |
Alessandro Gardini |
| E-mail(s) |
agardini@wistar.org
|
| Phone |
2158983755
|
| Organization name |
The Wistar Institute
|
| Lab |
Gardini Lab
|
| Street address |
3601 Spruce St, Room 230
|
| City |
Philadelphia |
| State/province |
PA |
| ZIP/Postal code |
19104 |
| Country |
USA |
| |
|
| Platform ID |
GPL30173 |
| Series (2) |
| GSE230917 |
Control of cell identity and early neuronal fate commitment by the enhancer module of Integrator [RNA-Seq] |
| GSE230928 |
Control of cell identity and early neuronal fate commitment by the enhancer module of Integrator |
|
| Relations |
| BioSample |
SAMN42019116 |
| SRA |
SRX25037650 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM8348316_NPC_P3-shINTS10-rep2_STAR_aln_to_genome_q10_srt_FOR.bw |
14.3 Mb |
(ftp)(http) |
BW |
| GSM8348316_NPC_P3-shINTS10-rep2_STAR_aln_to_genome_q10_srt_REV.bw |
13.6 Mb |
(ftp)(http) |
BW |
| GSM8348316_NPC_P3-shINTS10-rep2_gene.txt.gz |
927.1 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
|
|
|
|
 |
