|
| Status |
Public on Aug 02, 2024 |
| Title |
SMU_CoMitis_1 |
| Sample type |
SRA |
| |
|
| Source name |
whole cell lysate
|
| Organisms |
Streptococcus mutans; Streptococcus mitis |
| Characteristics |
tissue: whole cell lysate
strain: UA159 / ATCC 49456
cell type: planktonic bacterial culture
genotype: wild-type
treatment: TYG; growth to OD600 nm = 0.4
|
| Treatment protocol |
Cells were harvested by centrifugation at 4°C for 5 min, treated with bacterial RNAprotect Bacteria Reagent (Qiagen), and immediately stored at -80°C.
|
| Growth protocol |
Bacterial cells used for extraction of RNA were grown in TYG medium in the presence of 5% CO2 at 37°C without agitation, until they reached mid-exponential growth phase (OD600 nm ≈ 0.4)
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was extracted from bacterial cells using the RNeasy Mini kit (Qiagen), with chromosomal DNA removed using a DNase I kit (Qiagen). To remove 16S and 23S rRNAs, 10 µg of total RNA was treated using the MICROBExpressTM Bacterial mRNA Enrichment Kit
cDNA libraries were created from 100 ng enriched mRNA samples using the NEBNext Ultra Directional RNA Library Prep kit for Illumina and NEBNext multiplex Oligos for Illumina (New England Biolabs, Ipswich, MA) following instructions from the supplier.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
NextSeq 2000 |
| |
|
| Description |
SMU_CoMitis_1 / Mitis_CoSMU_1
|
| Data processing |
Step 1: FASTQ Groomer
Step 2: FASTQ Quality Trimmer
Step 3: Cutadapt removing GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
Step 4: Map with Bowtie for Illumina
Step 5: sort
Step 6: htseq-count (see our publication for details)
Assembly: NC_004350.2 for S. mutans UA159; CP079724.1 for S. oralis
Supplementary files format and content: tab-delimited text file includes raw counts for each sample
Supplementary files format and content: excel workbook file includes Log2 fold changes and Log10 P values from Degust output, as well as gene descriptions and normalized read counts
|
| |
|
| Submission date |
Jul 25, 2024 |
| Last update date |
Aug 02, 2024 |
| Contact name |
Justin Ray Kaspar |
| E-mail(s) |
kaspar.17@osu.edu
|
| Phone |
6142923773
|
| Organization name |
The Ohio State University
|
| Department |
Biosciences
|
| Lab |
Kaspar
|
| Street address |
305 W 12th Ave
|
| City |
Columbus |
| State/province |
OH |
| ZIP/Postal code |
43210 |
| Country |
USA |
| |
|
| Platform ID |
GPL34746 |
| Series (1) |
| GSE273140 |
A strain of Streptococcus mitis inhibits biofilm formation of caries pathogens via abundant hydrogen peroxide production |
|
| Relations |
| BioSample |
SAMN42826603 |
| SRA |
SRX25478601 |
