 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Feb 04, 2012 |
| Title |
6_Starvation |
| Sample type |
SRA |
| |
|
| Source name |
young adult animals exposed to complete food deprivation
|
| Organism |
Caenorhabditis elegans |
| Characteristics |
strain: spe-9(hc88)
gender: hermaphrodites
developmental stage: Day 0-1 post-L4 molt (young adult stage. Specifically, 66 hrs after synchronized L1 stage animals were placed bacterial plates)
growth condition: 23°C
stress conditions: Complete food deprivation for 12 hrs
|
| Treatment protocol |
Animals were exposed to each stress condition, including heat shock (32°C, 6 hrs), Hypoxia (0.01% oxygen, 6 hrs), Oxidation (Juglone 750microM, 6 hrs) and Starvation (complete food deprivation, 12 hrs). Total RNAs were purified from animals just after stress treatment. Also, for recovery from heat shock, animal exposed to heat stress (32°C, 6 hrs) were placed at 23°C for 6 hrs, and then used for RNA isolation. In addition, RNAs were prepared from normally cultured, untreated animals at three time points, 0 hr (baseline), 6 hrs (as controls for heat shock, hypoxia and oxidation) and 12 hrs (as controls for heat shock recovery and starvation) after starting stress exposure.
|
| Growth protocol |
spe-9(hc88, a sterile mutant) hermaphrodites were maintained for a few generations without starvation at 15°C to collect embryos. After embryos were harvested, they were incubated at 23°C without a food source in M9 buffer for 24 hrs with rotating to arrest their growth at the L1 stage. Synchronized animals were exposed to each stress when they were young adult (Day 0-1 post-L4 molt. More specifically, 66 hrs after synchronized L1 animals were placed on bacterial plates)
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNAs were prepared using the mirVana miRNA Isolation kit (Ambion), and 10 μg of total RNAs were used for cDNA library preparation for small RNAs using the DGE-Small RNA Sample Prep Kit ver. 1.0 (Illumina) according to the manufacturers' instructions.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer II |
| |
|
| Data processing |
The raw data were aligned to the C. elegans genome (genome build WormBase WS190) using the SOAP program (ver. 1.10 Li, R. et al., Bioinformatics 24: 713-714. 2008) with the following command options: –S 3 –A TCGTATGCCGTCTTCTGCTTGT (maximum 2 base pair mismatches were allowed as a default option). Then, the number of times of each read sequenced was examined.
The *Processed.txt files represent aligned, unique sequencing reads, and their counts observed.
Genome Build:
6_Starvation_Processed.txt: WormBase WS190
|
| |
|
| Submission date |
Feb 03, 2012 |
| Last update date |
May 15, 2019 |
| Contact name |
Frank J Slack |
| E-mail(s) |
frank.slack@yale.edu
|
| Organization name |
Yale University
|
| Department |
MCDB
|
| Street address |
266 Whitney Ave
|
| City |
New Haven |
| State/province |
CT |
| ZIP/Postal code |
06520 |
| Country |
USA |
| |
|
| Platform ID |
GPL9269 |
| Series (1) |
| GSE35529 |
MicroRNAs induced during response to stress in C. elegans |
|
| Relations |
| SRA |
SRX118460 |
| BioSample |
SAMN00780341 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM870225_6_Starvation_Processed.txt.gz |
4.0 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
