 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Dec 22, 2012 |
| Title |
CIP-PNK, insert size 18-40 nt adult |
| Sample type |
SRA |
| |
|
| Source name |
wild type, N2, adult
|
| Organism |
Caenorhabditis elegans |
| Characteristics |
5' barcode: TGAC
3' linker: CTGTAG
strain: N2
genotype/variation: wild type
age: adult
|
| Growth protocol |
Normal condition on OP50 plate at 20 oC
|
| Extracted molecule |
total RNA |
| Extraction protocol |
A. CapSeq protocol: To destroy 5.8S, 18S, and 26S rRNA, 0.5-2 µg of total RNA was treated with 0.1 U/µl Terminator exonuclease (Epicentre, TER51020) in 20 µl volume containing 1U/µl of SUPERase·InTM (Ambion, AM2696) and 1 X buffer A at 30 oC for 1-2 hr. The efficiency of the above reaction could be monitored by resolving the sample on a 5% denaturing PAGE gel visualized by Ethidium Bromide. To de-phosphorylate tRNA and 5S rRNA, the above reaction was diluted into 100 µl with 10 µl of 10X DNase I buffer, 20 U more of SUPERase·InTM, 30 U of CIP (NEB, M0290S), 5 U of DNase I (Ambion, AM2222), and H2O, and incubated at 37 oC for 30 minutes. The RNA was extracted using phenol/chloroform with phase-lock column (5PRIM, 2302830), and precipitated with 0.3M NaAc (pH 5.2) and at least 1 volume of isopropanol plus 30 µg of glycoblue (Ambion, AM9515), a procedure called as RNA cleanup. To expose the 5' phosphate in the cap structure, the RNA was treated with 0.25 U/µl TAP (tobacco acid pyrophosphatase, Epicentre, T19050) in 10 µl reaction containing 1U/µl SUPERase·InTM and 1 X TAP buffer at 37 oC for 1 hour, and then cleaned up, but without additional glycoblue because glycoblue was already added in the previous step. The RNA was ligated with 5 µM of barcoded 5’ linkers in 10 µl reaction containing 1 X buffer, 1 U/µl of SUPERase·InTM, 2 U/µl of T4 RNA ligase (Takara, 2050A), 10% DMSO, and 0.1 µg/µl BSA at 15 oC for 8 hours, and cleaned up without additional glycoblue. To make cDNA, the precipitated RNA was annealed with 50 pmole of RT oligo plus 10 nmole of dNTP (each nucleotide) in a 13 µl reaction at 65 oC for 5 min, and then chilled on ice for at least 2 minutes. The sample was incubated with 5 U/µl Superscript III (Invitrogen, 18080), 10 mM DTT, 1 U/µl SUPERase·InTM, and 1 X buffer, all of which brought in 7 µl volume to the previous annealing reaction. The RT was incubated at 15, 25, and 37 oC each for 15 min, and then at 50 oC for 30 min to finish the RT reaction. The RT was heat-inactivated at 85 oC for 5 min. To destroy RNA, 1 µl each of RNase A (Ambion, AM2270) and RNase H (Ambion, AM2292) is added to the RT reaction at 37 oC for 20 min. To increase the cDNA quantity, the RT reaction was diluted into 100 µl PCR reaction containing 1 X PCR buffer, 0.01 U/µl ExTaq (Takara, RR001B), 0.05 µM of oligo CMO13729, 0.2 mM dNTP, and H2O, and a linear PCR was performed for 12 cycles with condition 94 oC 20 s, 52 oC 20 s, and 72 oC 30 s. The cDNA of desired size (here ~ 130 to 170 nt for most samples or ~ 50-130 nt for ya0217), visualized using SYBRGold (Invitrogen, S-11494) with 5S and 5.8S RNA from the total RNA as size marker, was purified from a 15% denaturing PAGE gel. The cDNA was eluted using TE buffer (10 mM Tris pH 7.5, 1mM EDTA) containing 0.3 M NaCl for 6 hours to overnight with constant vortexing, filtered through 0.45 µm Spin-x column (Costar, 19442-758), and precipitated with isopropanol and glycoblue, as above. The whole procedure after PCR above was defined as PAGE gel purification. To obtain the optimal PCR cycle number to produce the cDNA, a testing PCR was performed in 50 µl reaction containing 1 X buffer, 0.2 µM each of oligo CMO13279 and solexa3sh, 20% of the eluted linear PCR product, 0.25 mM dNTP and 0.025 U/µl ExTaq, for 15 cycles with condition 94 oC 20 s, 52 oC 20 s, and 72 oC 30 s. And then 5 µl each of oligo solexa3 and CMO13278, each at 10 µM stock concentration, was added. 3 µl of PCR product was sampled at 3, 6, 9 and 12 more cycles, and then resolved on a 8% native PAGE gel visualized using Ethidium Bromide with 10 bp DNA marker (Invitrogen 10821-015). The optimal PCR cycle number was defined as the one at which the PCR reaction produces the cDNA of the desired size (here insert size 100 to 130 nt for most samples or 20-100 for ya0217) without obvious bulged products (diffusive band running much more slowly). This was the condition to make the final cDNA amplicons. To check the quality of the library, TA cloning followed by colony PCR was performed to obtain individual cDNA species sequenced using the traditional method. Finally, single end 76 or 100 nt sequence was obtained using Illumina Genome Analyzer or Hi-Seq. Oligo used in Capseq: RT oligo: CAGAAGACGGCATACGANNNNNNNN (N, random nucleotide) PCR oligo: solexa3: CAAGCAGAAGACGGCATACGA solexa3sh: GCAGAAGACGGCATACGA CM13279: GTTCTACAGTCCGACGATC CM13278: AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGACGATC 5' linker: DNA/RNA hybrid oligo (RNA preceded with ‘r’, otherwise DNA) TCTAC-rArGrUrCrCrGrArCrGrArUrC-barcode Barcodes: A-rTrGrArC, B-rCrArGrT, C-rGrCrTrG, D-rArTrCrA B. Small RNA cloning: We used ligation dependent method, as described (Gu et al., Molecular cell 36, 231-244, 2009) to make small RNA libraries. PRG-1 IP was performed using the same antibody and method, as described (Batista et al., Mol Cell 31, 67-78, 2008; Gu et al., Molecular cell 36, 231-244,2009). Unlike CIP-PNK cloning or ligation independent cloning, TAP cloning, which clones much less degradation products, was used to clone RNA from PRG-1 IP, the oxidized sample for enriching for the 3’ modified RNA (Gu et al., 2009), and the corresponding control samples. To clone capped small RNA, 18-40 nt RNA was first purified from 40 µg of total RNA using a 15% denaturing PAGE gel, and then treated with 0.5 U/µl CIP in 100 µl reaction containing 0.5 U/µl SUPERase·InTM and 1X CIP buffer at 37 oC for 1 hour. The dephosporylated RNA was cleaned up, ligated with a 3' linker, gel-purified, and split into two parts: one quarter treated with PNK and the rest treated with TAP. The treatment and the following cloning protocol were described previously (Gu et al.,Molecular cell 36, 231-244, 2009). Except the previously published oxidized sample (the first step of beta-elimination) and its control, other samples were cloned using 5' 4nt-barcoded linker. Single-end 36nt sequence was obtained using illumina genome analyzer.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer II |
| |
|
| Description |
Caenorhabditis elegans normal small RNA
|
| Data processing |
remove 5' barcode and its variants containing a single mutation, and then remove the 3' linker or the partial linker of at least 2nt at the very 3' end. And then for CapSeq, additional 8 nt was removed from the 3' end because of random priming.
Bowtie 0.12.7, blastn 2.2.25 and custom PERL (5.10.1) scripts were used to map and analyze the sequence. In general, all post-mapping analyses were performed using custom PERL scripts. Please contact Weifeng Gu at weifeng.gu@umassmed.edu for detailed PERL scripts or the related database.
Small RNA was normalized to 5 million of matched non-structural reads and mRNA was normalized to 10 million of sense protein coding reads
Gbrowse 1.70 is used to visualize the alignments.
Genome_build: WormBase release WS215, Repbase 15.10, and miRBase release 16 for C. elegans, and NCBIM37.67, miRBase 18 and non-coding RNA database fRNAdb 3.4 for mouse.
Supplementary_files_format_and_content: Fasta format for sequence with id containing the RNA read number (_xNo.)
|
| |
|
| Submission date |
Aug 10, 2012 |
| Last update date |
May 15, 2019 |
| Contact name |
Craig Mello |
| Organization name |
University of Massachusetts Medical School
|
| Department |
Program in Molecular Medicine
|
| Lab |
Craig Mello
|
| Street address |
368 Plantatoin Street, Suite AS5-2047
|
| City |
Worcester |
| State/province |
MA |
| ZIP/Postal code |
01605 |
| Country |
USA |
| |
|
| Platform ID |
GPL9269 |
| Series (1) |
| GSE40053 |
C. elegans piRNAs are processed from capped-small RNAs transcribed at promoters throughout the genome |
|
| Relations |
| SRA |
SRX176315 |
| BioSample |
SAMN01113015 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM984435_CIPPNK0118_processed.fa.gz |
16.0 Mb |
(ftp)(http) |
FA |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
