NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL18498 Query DataSets for GPL18498
Status Public on Mar 28, 2014
Title IMB yeast 7K operon oligo array for gene expression
Technology type spotted oligonucleotide
Distribution non-commercial
Organism Saccharomyces cerevisiae
Manufacturer Microarray Core Facility of the Institute of Molecular Biology, Academia Sinica, TW.
Manufacture protocol Arrays were printed by standard protocols on CodeLink Activated slides (GE Healthcare) using a Gene Machine (San Carlos, CA) OmniGrid 100 Instrument.
 
 
Submission date Mar 28, 2014
Last update date Apr 01, 2014
Contact name Jun-Yi Leu
E-mail(s) jyl9216public@gmail.com
Organization name Institute of Molecular Biology
Lab N411
Street address No. 128, Sec. 2, Academia Rd., Nangang Dist.
City Taipei
ZIP/Postal code 115
Country Taiwan
 
Samples (69) GSM1357376, GSM1357377, GSM1357378, GSM1357379, GSM1357380, GSM1357381 
Series (4)
GSE56186 Saccharomyces cerevisiae mutant strain with R1158 strain background: Fold change after doxycycline treatment
GSE76595 Karyotype analysis of polyploid Saccharomyces cerevisiae cell lines
GSE76596 Whole genome gene expression analysis of evolved polyploid Saccharomyces cerevisiae cell lines at 36 degrees Celsius

Data table header descriptions
ID
ORF ORF name, locus tag
GB_LIST GenBank accession numbers
Common Standard name
Synonyms Synonyms
GenBank GenBank accession number of spotted sequence
Map Chromosomal location
Chromosome Chromosome
SEQUENCE Oligonucleotide sequence
Description Description

Data table
ID ORF GB_LIST Common Synonyms GenBank Map Chromosome SEQUENCE Description
Q0010_01 Q0010 Q0010 - 17:4119..4188 17 ATATTTATATTATATAATTAATTATATCGTTTATACTCCTTCGGGGTCCCCGCCGGGGCGGGGACTTTAT Dubious mitochondrial open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; partially overlaps the dubious ORF Q0017
Q0017_01 Q0017 Q0017 - 17:4314..4383 17 CGTCTCCGAGGTCCCGGTTTCGTAAGAAACCGGGACTTATATATTTATAAATATAAATCTAACTTAATTA Dubious mitochondrial open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; partially overlaps the dubious ORF Q0010
Q0032_01 Q0032 Q0032 - 17:11705..11792 17 CTATCCTATATTATCCTATCATATAATATCATATCATATTATATTATATCTTATTATATGATATATAAAGTATTCACTCTATATGAGG Hypothetical protein
Q0045_01 Q0045 COX1 COX1 - 17:14953..15022 17 ATGTATTATCAATGGGTGCTATTTTCTCTTTATTTGCAGGATACTATTATTGAAGTCCTCAAATTTTAGG Subunit I of cytochrome c oxidase, which is the terminal member of the mitochondrial inner membrane electron transport chain; one of three mitochondrially-encoded subunits
Q0050_01 Q0050 L36897 AI1 AI1 L36897 17:16053..16122 17 GTAACTGATCCTTTTGAATATATCGATTCAATTAAATATATATTACCTACAGCTAAAGCTAATTTTAATA Reverse transcriptase required for splicing of the COX1 pre-mRNA, encoded by a mobile group II intron within the mitochondrial COX1 gene
Q0055_01 Q0055 AI2 AI2 - 17:16013..16082 17 GAAAGTTATTTTAAAATTCGGTAAAGTATTAGTTGATCCTCATTCAAAAGTTAGTTTTAGTATTGATGAT Reverse transcriptase required for splicing of the COX1 pre-mRNA, encoded by a mobile group II intron within the mitochondrial COX1 gene
Q0060_01 Q0060 AI3 AI3 - 17:14560..14629 17 TAAATGGTAAAAATCGTTCTAGTAGAGCAATGCCTTATTATTGTTTAGAATTAAGACAAAATTATCAAAA Endonuclease I-SceIII, encoded by a mobile group I intron within the mitochondrial COX1 gene
Q0065_01 Q0065 AI4 AI4 - 17:15083..15152 17 TGTTGGATTTTTTGATGCTGATGGTACAATTAATTATTCATTTAAAAATAATCATCCTCAATTAACAATT Endonuclease I-SceII, encoded by a mobile group I intron within the mitochondrial COX1 gene; intron is normally spliced by the BI4p maturase but AI4p can mutate to acquire the same maturase activity
Q0070_01 Q0070 AI5_ALPHA AI5_ALPHA - 17:15441..15510 17 ATATGTGATGGTTCATTTGTAAAAGGTGGAGGTTTATATTTAAATTTACAATCTTTTCTAACTAAAGAAT Endonuclease I-SceIV, involved in intron mobility; encoded by a mobile group I intron within the mitochondrial COX1 gene
Q0075_01 Q0075 AI5_BETA AI5_BETA - 17:24901..24970 17 GTATTTTAAAAAGAGATTATAAATCTGGTGCTACAGCTTATATTTATAAAGCTCAATCATCAAAAGCTAT Protein of unknown function, encoded within an intron of the mitochondrial COX1 gene; translational initiation codon is predicted to be ATA rather than ATG
Q0080_01 Q0080 ATP8 AAP1 - 17:27711..27790 17 GGTTTCTTATTAATGATTCTATTATTAATTTTATTCTCACAATTCTTTTTACCTATGATCTTAAGATTATATGTATCTAG Subunit 8 of the F0 sector of mitochondrial inner membrane F1-F0 ATP synthase, encoded on the mitochondrial genome
Q0085_01 Q0085 J01464 L36897 M36379 V00683 X05056 ATP6 ATP6 J01464|L36897|M36379|V00683|X05056 17:29047..29116 17 AGGTTCTAATATCTTAGCTGGTCATTTATTAATGGTTATTTTAGCTGGTTTACTATTTAATTTTATGTTA Mitochondrially encoded subunit 6 of the F0 sector of mitochondrial F1F0 ATP synthase, which is a large, evolutionarily conserved enzyme complex required for ATP synthesis
Q0092_01 Q0092 Q0092 - 17:30895..30964 17 ATATTCATTATATTTATAATTATATATAATGTAATACGGGTAAACATTACCCGTTGTTCACGGGTAATGT Hypothetical protein
Q0105_01 Q0105 COB COB - 17:37278..37347 17 TCACCTAATACTTTAGGTCATCCTGATAACTATATTCCTGGTAATCCTTTAGTAACACCAGCATCTATTG Cytochrome b, mitochondrially encoded subunit of the ubiquinol-cytochrome c reductase complex which includes Cobp, Rip1p, Cyt1p, Cor1p, Qcr2p, Qcr6p, Qcr7p, Qcr8p, Qcr9p, and Qcr10p
Q0110_01 Q0110 BI2 BI2 - 17:37542..37611 17 TTAGCTTTAGCTATTTGAATTATAGATGATGGATGTAAATTAGGTAAAGGTTTAAAATTCACAACTAATT Mitochondrial mRNA maturase with a role in splicing, encoded by both exon and intron sequences of partially processed COB mRNA
Q0115_01 Q0115 BI3 BI3 - 17:37770..37839 17 GCTGAAAGTTGTTTTAGTATTTATAAACCTATAAATAAAAAAATAAAACTTGCTAGTTTTGAAGTATCTC Mitochondrial mRNA maturase, forms a complex with Mrs1p to mediate splicing of the bI3 intron of the COB gene; encoded by both exon and intron sequences of partially processed COB mRNA
Q0120_01 Q0120 BI4 BI4 - 17:38137..38206 17 AAATTAGACCTCAATTAACTATTAGCGTTACAAATAAATATTTACATGATGTTGAATACTATAGAGAAGT Mitochondrial mRNA maturase, forms a complex with Nam2p to mediate splicing of the bI4 intron of the COB gene; encoded by both exon and intron sequences of partially processed COB mRNA
Q0130_01 Q0130 J01462 L00007 L36899 V00707 X03968 X05357 X05358 OLI1 OLI1 J01462|L00007|L36899|V00707|X03968|X05357|X05358 17:46834..46903 17 TCAAGAAACCCATCAATTAAAGACCTAGTATTCCCTATGGCTATTTTAGGTTTCGCCTTATCAGAAGCTA F0-ATP synthase subunit 9 (ATPase-associated proteolipid), encoded on the mitochondrial genome; mutation confers oligomycin resistance; expression is specifically dependent on the nuclear genes AEP1 and AEP2
Q0140_01 Q0140 V00705 VAR1 VAR1 V00705 17:49873..49942 17 GTTGGTTGATCTATTAAATTTAAAGGTAGATTAAGTAATAATAATGGTAGAACTAGTACACTTAATTTAT Mitochondrial ribosomal protein of the small subunit, mitochondrially-encoded; polymorphic in different strains due to variation in number of AAT (asparagine) codons; translated near the mitochondrial inner membrane
Q0142_01 Q0142 Q0142 - 17:51059..51128 17 GTTCCGGAACTCCTCCTTCTCGCGAGGTTAACACCTATTATATAACTATAACTATAACTATAACTATAAT Hypothetical protein

Total number of rows: 6400

Table truncated, full table size 1886 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap