 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 12, 2014 |
| Title |
Agilent_033054 Genome-wide Atlantic cod microarray, second version_ACIQ1 |
| Technology type |
in situ oligonucleotide |
| Distribution |
custom-commercial |
| Organism |
Gadus morhua |
| Manufacturer |
Agilent Technologies |
| Manufacture protocol |
see manufacturer's web site at http://www.agilent.com/
|
| |
|
| |
|
| Contributor(s) |
Krasnov A |
| Submission date |
Jun 11, 2014 |
| Last update date |
Jun 12, 2014 |
| Contact name |
Aleksei Krasnov |
| E-mail(s) |
aleksei.krasnov@nofima.no
|
| Phone |
+47 97602165
|
| Organization name |
Nofima AS
|
| Department |
Fish Health
|
| Street address |
Osloveien 1
|
| City |
Aas |
| ZIP/Postal code |
1430 |
| Country |
Norway |
| |
|
| Samples (21)
|
GSM1409792, GSM1409793, GSM1409794, GSM1409795, GSM1409796, GSM1409797
GSM1409798, GSM1409799, GSM1409800, GSM1409801, GSM1409802, GSM1409803, GSM1409804, GSM3489939, GSM3489940, GSM3489941, GSM3489942, GSM3489943, GSM3489944, GSM3489945, GSM3489946
|
| Series (2) |
| GSE58392 |
Genome-wide microarray analysis of Atlantic cod (Gadus morhua) oocyte and embryo |
| GSE122988 |
Microarray analysis of gene expression of Atlantic cod from different Baltic Sea regions |
|
| Data table header descriptions |
| ID |
|
| Column |
|
| Row |
|
| SPOT_ID |
|
| Ensembl Accession |
|
| GB_ACC |
GenBank Accession number |
| Source |
|
| SEQUENCE |
|
| Data table |
| ID |
Column |
Row |
SPOT_ID |
Ensembl Accession |
GB_ACC |
Source |
SEQUENCE |
| 1 |
1 |
1 |
GE_BrightCorner |
|
|
|
|
| 2 |
2 |
1 |
GE_BrightCorner |
|
|
|
|
| 3 |
3 |
1 |
DarkCorner |
|
|
|
|
| 4 |
4 |
1 |
DarkCorner |
|
|
|
|
| 5 |
5 |
1 |
DarkCorner |
|
|
|
|
| 6 |
6 |
1 |
DarkCorner |
|
|
|
|
| 7 |
7 |
1 |
DarkCorner |
|
|
|
|
| 8 |
8 |
1 |
DarkCorner |
|
|
|
|
| 9 |
9 |
1 |
DarkCorner |
|
|
|
|
| 10 |
10 |
1 |
DarkCorner |
|
|
|
|
| 11 |
11 |
1 |
DarkCorner |
|
|
|
|
| 12 |
12 |
1 |
DarkCorner |
|
|
|
|
| 13 |
13 |
1 |
DarkCorner |
|
|
|
|
| 14 |
14 |
1 |
DarkCorner |
|
|
|
|
| 15 |
15 |
1 |
DarkCorner |
|
|
|
|
| 16 |
16 |
1 |
DarkCorner |
|
|
|
|
| 17 |
17 |
1 |
DarkCorner |
|
|
|
|
| 18 |
18 |
1 |
DarkCorner |
|
|
|
|
| 19 |
19 |
1 |
DarkCorner |
|
|
|
|
| 20 |
20 |
1 |
Gmr#S44166622 |
|
FG272864 |
Genbank |
GTACAGTATACTATATTGTATCCTTAATATGCCGTCTGTAAAGTTTTGCACGTTACGAGG |
Total number of rows: 45220
Table truncated, full table size 4646 Kbytes.
| Supplementary data files not provided |
|
|
|
|
 |
Less...
More...