NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL3710 Query DataSets for GPL3710
Status Public on Dec 22, 2006
Title Daphnia magna DGC cDNA array ver.1
Technology type spotted DNA/cDNA
Distribution non-commercial
Organism Daphnia magna
Manufacturer UC Berkeley Dept. of Nutr. Sci. and Toxicology Genomics Facility
Manufacture protocol The 5000 randomly selected cDNA clones from the Daphnia Genome Consortium (DGC) library (generous gift from D. Bauer at University of New Hampshire, NH and J. Colbourne at Indiana University, IN) were PCR amplified from the pDNR-LIB vector using the following primers: forward: AGTCGACGGTACCGGACATA and reverse: GCCAAACGAATGGTCTAGAAA. PCR products were purified by ethanol precipitation and resuspended in distilled water. cDNA clones were printed onto lysine-coated glass slides (Cheung et al. 1999).
Cheung VG, Morley M, Aguilar F, Massimi A, Kucherlapati R, Childs G. 1999. Making and reading microarrays. Nat Genet 21:15-9.
Support glass
Coating polysine
 
 
Contributor(s) Holman PS, Poynton HC, Bauer DJ, Colbourne JK
Submission date Apr 29, 2006
Last update date Dec 22, 2006
Contact name Helen C Poynton
E-mail(s) helen.poynton@umb.edu
Phone 617-287-7323
Organization name UMass Boston
Department School for the Environment
Lab Poynton Lab
Street address 100 Morrissey Blvd.
City Boston
State/province MA
ZIP/Postal code 02125
Country USA
 
Samples (83) GSM107567, GSM107581, GSM107582, GSM107583, GSM107584, GSM107585 
Series (3)
GSE4759 1/10 LC50 metal exposures to Daphnia magna
GSE7668 Concentration dependent gene expression changes in Daphnia magna exposed to metals
GSE13169 Gene expression profiling in Daphnia magna, Part III: Uncovering Biomarkers for Metal and ORC exposures

Data table header descriptions
ID
Plate_ID cDNA library plate where clone can be found
Well_ID Well where clone can be found
CLONE ID
GB_ACC Genbank accession
SPOT_ID

Data table
ID Plate_ID Well_ID CLONE ID GB_ACC SPOT_ID
1 P1A A1 none unknown
2 P1A A3 none unknown
3 P1A A5 none unknown
4 P1A A7 none unknown
5 P1A A9 none unknown
6 P1A A11 none unknown
7 P1A C1 none unknown
8 P1A C3 none unknown
9 P1A C5 none unknown
10 P1A C7 none unknown
11 P1A C9 none unknown
12 P1A C11 none unknown
13 P1A E1 none unknown
14 P1A E3 none unknown
15 P1A E5 none unknown
16 P1A E7 none unknown
17 P1A E9 none unknown
18 P1A E11 none unknown
19 P1A G1 none unknown
20 P1A G3 none unknown

Total number of rows: 4992

Table truncated, full table size 129 Kbytes.






Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap