NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL4411 Query DataSets for GPL4411
Status Public on Oct 12, 2006
Title Ambion Human_Mouse_Rat mirVANA miRNA Bioarray_1566V1
Technology type spotted oligonucleotide
Distribution custom-commercial
Organisms Homo sapiens; Mus musculus; Rattus norvegicus
Manufacturer Ambion, Inc.
Manufacture protocol CodeLink(tm) Activated Slides are designed to covalently immobilize amine-modified DNA for microarrays. They are easy to use and are compatible with most available arraying and scanning instruments. CodeLink Activated Slides are coated with a novel 3-D surface chemistry comprised of a long-chain, hydrophilic polymer containing amine-reactive groups. This polymer is covalently crosslinked to itself and to the surface of the slide. The crosslinked polymer, combined with end-point attachment, orients the immobilized DNA, and holds it away from the surface of the slide.
Technical specifications:
Slide dimensions: 25 × 75 × 1 mm
1× Printing buffer: 50 mM sodium phosphate at pH 8.5
Codelink slides are manufacured by SurModics and were formally sold as 3D-Link(tm) Activated Slides.
Catalog number 1566V1
Support glass
Coating other
 
Description Manufactured using GE Healthcare’s CodeLink (TM) 3-D Gel Matrix Technology
Surface type: non-adsorptive
Attachment: covalent
The mirVana miRNA Bioarrays are an Ambion product that is manufactured by GE Healthcare and incorporates the CodeLink™ 3-D Gel Matrix slide surface. This aqueous environment elevates the probes away from the surface of the slide, allowing for maximum interaction between the probes and targets.
 
Web link http://www.ambion.com/catalog/CatNum.php?1566V1
Contributor(s) Marsit CJ, Kelsey KT, Eddy K
Submission date Oct 11, 2006
Last update date Mar 18, 2008
Contact name Carmen J Marsit
E-mail(s) cmarsit@hsph.harvard.edu
Organization name Harvard School of Public Health
Department Genetics and Complex Diseases
Lab Kelsey
Street address 665 Huntington Avenue
City Boston
State/province MA
ZIP/Postal code 02115
Country USA
 
Samples (99) GSM139803, GSM139804, GSM139805, GSM139806, GSM139807, GSM139808 
Series (3)
GSE6020 MiRNA Expression data from Tk6 cell treated with arsenic, gamma-IR, or grown under folate-deficiency
GSE10259 Characterization of microRNA expression in colorectal cancer
GSE15644 miRNA expression profiling of stage specific monocyte derived dendritic cell differentiation

Data table header descriptions
ID
Oligo_ID Oligo identifier
Human Mature Sanger Registry Name Registry name in Sanger's mirBase, human, http://microrna.sanger.ac.uk
Human Sanger Accession Number(s) Accession number for Sanger's mirBASE, human, http://microrna.sanger.ac.uk
Mouse Mature Sanger Registry Name Registry name in Sanger's mirBase, mouse, http://microrna.sanger.ac.uk
Mouse Sanger Accession Number(s) Accession number for Sanger's mirBASE, mouse, http://microrna.sanger.ac.uk
Rat Mature Sanger Registry Name Registry name in Sanger's mirBase, rat, http://microrna.sanger.ac.uk
Rat Sanger Accession Number(s) Accession number for Sanger's mirBASE, rat, http://microrna.sanger.ac.uk
SEQUENCE
ORF
SPOT_ID

Data table
ID Oligo_ID Human Mature Sanger Registry Name Human Sanger Accession Number(s) Mouse Mature Sanger Registry Name Mouse Sanger Accession Number(s) Rat Mature Sanger Registry Name Rat Sanger Accession Number(s) SEQUENCE ORF SPOT_ID
Control_1 BA10001 Control_1
Control_2 BA10002 Control_2
Control_3 BA10003 Control_3
Control_4 BA10004 Control_4
hsa_let_7a BA10101 hsa-let-7a MI0000060,MI0000061,MI0000062 rno-let-7a MI0000827,MI0000828 UGAGGUAGUAGGUUGUAUAGUU let_7a hsa_let_7a
hsa_let_7b BA10102 hsa-let-7b MI0000063 mmu-let-7b MI0000558 rno-let-7b MI0000829 UGAGGUAGUAGGUUGUGUGGUU let_7b hsa_let_7b
hsa_let_7c BA10103 hsa-let-7c MI0000064 mmu-let-7c MI0000559,MI0000560 rno-let-7c MI0000830,MI0000831 UGAGGUAGUAGGUUGUAUGGUU let_7c hsa_let_7c
hsa_let_7d BA10104 hsa-let-7d MI0000065 mmu-let-7d MI0000405 rno-let-7d MI0000601 AGAGGUAGUAGGUUGCAUAGU let_7d hsa_let_7d
hsa_let_7e BA10105 hsa-let-7e MI0000066 mmu-let-7e MI0000561 rno-let-7e MI0000832 UGAGGUAGGAGGUUGUAUAGU let_7e hsa_let_7e
hsa_let_7f BA10106 hsa-let-7f MI0000067,MI0000068 rno-let-7f MI0000833,MI0000834 UGAGGUAGUAGAUUGUAUAGUU let_7f hsa_let_7f
hsa_let_7g BA10107 hsa-let-7g MI0000433 mmu-let-7g MI0000137 UGAGGUAGUAGUUUGUACAGU let_7g hsa_let_7g
hsa_let_7i BA10108 hsa-let-7i MI0000434 mmu-let-7i MI0000138 rno-let-7i MI0000835 UGAGGUAGUAGUUUGUGCUGU let_7i hsa_let_7i
hsa_miR_1 BA10109 hsa-miR-1 MI0000651,MI0000437 mmu-miR-1 MI0000139,MI0000652 UGGAAUGUAAAGAAGUAUGUA hsa-miR-1
hsa_miR_100 BA10110 hsa-miR-100 MI0000102 mmu-miR-100 MI0000692 rno-miR-100 MI0000885 AACCCGUAGAUCCGAACUUGUG miR_100
hsa_miR_101 BA10111 hsa-miR-101 MI0000103,MI0000739 mmu-miR-101a MI0000148 rno-miR-101 MI0000886 UACAGUACUGUGAUAACUGAAG miR_101
hsa_miR_103 BA10112 hsa-miR-103 MI0000109,MI0000108 mmu-miR-103 MI0000587,MI0000588 rno-miR-103 MI0000888,MI0000887 AGCAGCAUUGUACAGGGCUAUGA miR_103
hsa_miR_105 BA10113 hsa-miR-105 MI0000111,MI0000112 UCAAAUGCUCAGACUCCUGU miR_105
hsa_miR_106a BA10114 hsa-miR-106a MI0000113 AAAAGUGCUUACAGUGCAGGUAGC miR_106a
hsa_miR_106b BA10115 hsa-miR-106b MI0000734 mmu-miR-106b MI0000407 rno-miR-106b MI0000889 UAAAGUGCUGACAGUGCAGAU miR_106b
hsa_miR_107 BA10116 hsa-miR-107 MI0000114 mmu-miR-107 MI0000684 rno-miR-107 MI0000890 AGCAGCAUUGUACAGGGCUAUCA miR_107

Total number of rows: 389

Table truncated, full table size 35 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap