NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL7038 Query DataSets for GPL7038
Status Public on Dec 22, 2008
Title INSERM-Agilent-014850 Whole Human Genome Microarray 4x44K (G4112F)
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Homo sapiens
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at http://www.agilent.com/
Catalog number G4112F
 
Description
This multi-pack (4X44K) formatted microarray represents a compiled view of the human genome as it is understood today. The sequence information used to design this product was derived from a broad survey of well known sources such as RefSeq, Goldenpath, Ensembl, Unigene and others. The resulting view of the human genome covers 41K unique genes and transcripts which have been verified and optimized by alignment to the human genome assembly and by Agilent's Empirical Validation process.

Arrays of this design have barcodes that begin with 16014850 or 2514850.

Orientation:
Features are numbered numbered Left-to-Right, Top-to-Bottom as scanned by an Agilent scanner (barcode on the left, DNA on the back surface, scanned through the glass), matching the FeatureNum output from Agilent's Feature Extraction software.

Alternative version of GPL4133
 
Submission date Jul 10, 2008
Last update date Jan 17, 2013
Contact name David M Mutch
E-mail(s) dmmutch_sci@hotmail.com
Phone +33-1-4234-6956
Fax +33-1-4234-6993
Organization name INSERM UMRS U872 (Eq 7) Nutriomique
Department Nutrition and Metabolism
Street address Centre de Recherche des Cordeliers (CRC), 15 rue de l'├ęcole de m├ędecine
City Paris
ZIP/Postal code 75006
Country France
 
Samples (13) GSM304655, GSM304656, GSM304657, GSM304658, GSM304659, GSM304660 
Series (3)
GSE12050 Subcutaneous adipose tissue from lean and obese subjects
GSE45902 Identification of hsa-miR-135a target genes in the HeLa cell line
GSE45903 Identification of hsa-miR-135a target genes in LNCaP and HeLa cell lines

Data table header descriptions
ID
SPOT_ID Spot identifier
NAME Name
CONTROL_TYPE Control type
REFSEQ RefSeqAccession
GB_ACC GenBankAccession
GENE Entrez Gene ID
GENE_SYMBOL Gene Symbol
GENE_NAME Gene Name
UNIGENE_ID UnigeneID
ENSEMBL_ID EnsemblID
TIGR_ID TIGRID
ACCESSION_STRING Accession String
CHROMOSOMAL_LOCATION Chromosomal Location
CYTOBAND Cytoband
DESCRIPTION Description
GO_ID GoIDs
SEQUENCE

Data table
ID SPOT_ID NAME CONTROL_TYPE REFSEQ GB_ACC GENE GENE_SYMBOL GENE_NAME UNIGENE_ID ENSEMBL_ID TIGR_ID ACCESSION_STRING CHROMOSOMAL_LOCATION CYTOBAND DESCRIPTION GO_ID SEQUENCE
1 A_23_P38816 NM_130786 FALSE NM_130786 NM_130786 1 A1BG alpha-1-B glycoprotein Hs.529161 ENST00000263100 THC2282572 ref|NM_130786|gb|BC035719|gb|AF414429|ens|ENST00000263100 chr19:63548378-63548356 hs|19q13.43 "Homo sapiens alpha-1-B glycoprotein (A1BG), mRNA [NM_130786]" GO:0005554(molecular function unknown)|GO:0005576(extracellular region) CCTGGTGGCAGAAAGCTGATGCAGCCGCGGGCCCAGAGGTGCTGTTGGTGTCCTCAGAAG
2 A_24_P151121 NM_130786 FALSE NM_130786 NM_130786 1 A1BG alpha-1-B glycoprotein Hs.529161 ENST00000263100 THC2246972 ref|NM_130786|ens|ENST00000263100|gb|AK056201|thc|THC2246972 chr19:63549018-63548959 hs|19q13.43 "Homo sapiens alpha-1-B glycoprotein (A1BG), mRNA [NM_130786]" GO:0005554(molecular function unknown)|GO:0005576(extracellular region) GCTAGTGATCTGGTTTACTGCCTTAGTAATATCTAGTTCCTAATATGCCTATGCCTTTTA
3 A_23_P116898 NM_000014 FALSE NM_000014 NM_000014 2 A2M alpha-2-macroglobulin Hs.212838 ENST00000318602 NP1278694 ref|NM_000014|ens|ENST00000318602|gb|AB209614|gb|CR621613 chr12:9112685-9112626 hs|12p13.31 "Homo sapiens alpha-2-macroglobulin (A2M), mRNA [NM_000014]" GO:0004867(serine-type endopeptidase inhibitor activity)|GO:0005576(extracellular region)|GO:0006886(intracellular protein transport)|GO:0008320(protein carrier activity)|GO:0017114(wide-spectrum protease inhibitor activity)|GO:0019899(enzyme binding)|GO:0019959(interleukin-8 binding)|GO:0019966(interleukin-1 binding)|GO:0043120(tumor necrosis factor binding)|GO:0051260(protein homooligomerization) CTTGTTCTTCACGGTTCTGCAAGATGTCCCAGTAAGAGATCTGAAACCAGCCATAGTGAA
4 A_23_P95594 NM_000662 FALSE NM_000662 NM_000662 9 NAT1 N-acetyltransferase 1 (arylamine N-acetyltransferase) Hs.591847 ENST00000307719 THC2253667 ref|NM_000662|ens|ENST00000307719|ens|ENST00000357526|gb|D90041 chr8:18124656-18124715 hs|8p22 "Homo sapiens N-acetyltransferase 1 (arylamine N-acetyltransferase) (NAT1), mRNA [NM_000662]" GO:0004060(arylamine N-acetyltransferase activity)|GO:0008152(metabolism)|GO:0016407(acetyltransferase activity)|GO:0016740(transferase activity) TCCTTGCAGAGAAAGCTTGTGCCCAAACATGGTGATAGATTTTTTACTATTTAGAATAAG
5 A_23_P31798 NM_000015 FALSE NM_000015 NM_000015 10 NAT2 N-acetyltransferase 2 (arylamine N-acetyltransferase) Hs.2 ENST00000286479 THC2238416 ref|NM_000015|ens|ENST00000286479|gb|CR407631|gb|BC015878 chr8:18302422-18302481 hs|8p22 "Homo sapiens N-acetyltransferase 2 (arylamine N-acetyltransferase) (NAT2), mRNA [NM_000015]" GO:0004060(arylamine N-acetyltransferase activity)|GO:0008152(metabolism)|GO:0016407(acetyltransferase activity)|GO:0016740(transferase activity) AGACGTCTCCAACATCTTCATTTATAACCACATCATTTTGTTCCTTGCAGACCCCAGAAG
6 A_23_P162918 NM_001085 FALSE NM_001085 NM_001085 12 SERPINA3 "serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3" Hs.534293 ENST00000261981 NP1215191 ref|NM_001085|ens|ENST00000261981|gb|AB209060|gb|AY513275 chr14:94150936-94150995 hs|14q32.13 "Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 (SERPINA3), mRNA [NM_001085]" GO:0003677(DNA binding)|GO:0005515(protein binding)|GO:0005576(extracellular region)|GO:0005622(intracellular)|GO:0006953(acute-phase response)|GO:0006954(inflammatory response)|GO:0019216(regulation of lipid metabolism)|GO:0030569(chymotrypsin inhibitor activity) GAGTATGGGAAATGCCATGTTTGTCAAAGAGCAACTCAGTCTGCTGGACAGGTTCACGGA
7 A_23_P2920 NM_001085 FALSE NM_001085 NM_001085 12 SERPINA3 "serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3" Hs.534293 ENST00000261981 NP1215191 ref|NM_001085|ens|ENST00000261981|gb|AY513275|gb|CR609815 chr14:94158435-94158494 hs|14q32.13 "Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 (SERPINA3), mRNA [NM_001085]" GO:0003677(DNA binding)|GO:0005515(protein binding)|GO:0005576(extracellular region)|GO:0005622(intracellular)|GO:0006953(acute-phase response)|GO:0006954(inflammatory response)|GO:0019216(regulation of lipid metabolism)|GO:0030569(chymotrypsin inhibitor activity) ATAGGTGAGCTCTACCTGCCAAAGTTTTCCATCTCGAGGGACTATAACCTGAACGACATA
8 A_23_P80570 NM_001086 FALSE NM_001086 NM_001086 13 AADAC arylacetamide deacetylase (esterase) Hs.506908 ENST00000232892 THC2237959 ref|NM_001086|ens|ENST00000232892|gb|CR624107|gb|L32179 chr3:153028481-153028540 hs|3q25.1 "Homo sapiens arylacetamide deacetylase (esterase) (AADAC), mRNA [NM_001086]" GO:0005783(endoplasmic reticulum)|GO:0005789(endoplasmic reticulum membrane)|GO:0005792(microsome)|GO:0008152(metabolism)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0016298(lipase activity)|GO:0019213(deacetylase activity) ATATGATCTCTTAAGAGATGATGGACTCATGTATGTCACCCGACTTCGCAACACTGGGGT
9 A_23_P56529 NM_001087 FALSE NM_001087 NM_001087 14 AAMP "angio-associated, migratory cell protein" Hs.83347 ENST00000248450 NP838312 ref|NM_001087|gb|AB209790|gb|AK131047|gb|BC014122 chr2:218955657-218955402 hs|2q35 "Homo sapiens angio-associated, migratory cell protein (AAMP), mRNA [NM_001087]" GO:0006928(cell motility)|GO:0008201(heparin binding) GGACCTTGGCCATCTATGACCTGGCTACGCAGACTCTTAGGCATCAGTGTCAGCACCAGT
10 A_23_P152527 NM_001088 FALSE NM_001088 NM_001088 15 AANAT arylalkylamine N-acetyltransferase Hs.431417 ENST00000250615 NP1161709 ref|NM_001088|ens|ENST00000250615|gb|BC069434|gb|U40347 chr17:71976911-71976970 hs|17q25.1 "Homo sapiens arylalkylamine N-acetyltransferase (AANAT), mRNA [NM_001088]" GO:0004059(aralkylamine N-acetyltransferase activity)|GO:0007623(circadian rhythm)|GO:0008415(acyltransferase activity)|GO:0016740(transferase activity) CCTATGTCCAGAGCTGTCCCTGGGCTGGTTCGAGGAGGGCTGCCTTGTGGCCTTCATCAT
11 A_24_P172990 NM_001605 FALSE NM_001605 NM_001605 16 AARS alanyl-tRNA synthetase Hs.315137 ENST00000261772 THC2235858 ref|NM_001605|ens|ENST00000261772|gb|D32050|gb|BC011451 chr16:68845436-68845377 hs|16q22.1 "Homo sapiens alanyl-tRNA synthetase (AARS), mRNA [NM_001605]" GO:0000049(tRNA binding)|GO:0000166(nucleotide binding)|GO:0003676(nucleic acid binding)|GO:0004813(alanine-tRNA ligase activity)|GO:0005524(ATP binding)|GO:0005625(soluble fraction)|GO:0005737(cytoplasm)|GO:0006412(protein biosynthesis)|GO:0006419(alanyl-tRNA aminoacylation)|GO:0008033(tRNA processing)|GO:0016874(ligase activity) GCCACTGCAGTCATCCCCCAGTGGCAGAAGGATGAATTGCGGGAGACTCTCAAATCCCTA
12 A_23_P152505 NM_020686 FALSE NM_020686 NM_020686 18 ABAT 4-aminobutyrate aminotransferase Hs.336768 ENST00000268251 THC2434537 ref|NM_020686|ref|NM_000663|gb|BC008990|ens|ENST00000268251 chr16:8785829-8785888 hs|16p13.2 "Homo sapiens 4-aminobutyrate aminotransferase (ABAT), nuclear gene encoding mitochondrial protein, transcript variant 1, mRNA [NM_020686]" GO:0003867(4-aminobutyrate transaminase activity)|GO:0005739(mitochondrion)|GO:0005759(mitochondrial matrix)|GO:0007268(synaptic transmission)|GO:0009448(gamma-aminobutyric acid metabolism)|GO:0016740(transferase activity)|GO:0030170(pyridoxal phosphate binding)|GO:0042135(neurotransmitter catabolism)|GO:0047298((S)-3-amino-2-methylpropionate transaminase activity) TAACATGTCACAATGTAACGGATGACCATATGCACAATTCCATGAATTAAATCTGTTTCC
13 A_24_P330684 NM_020686 FALSE NM_020686 NM_020686 18 ABAT 4-aminobutyrate aminotransferase Hs.336768 ENST00000268251 THC2238269 ref|NM_020686|ref|NM_000663|ens|ENST00000268251|gb|S75578 chr16:8780872-8780931 hs|16p13.2 "Homo sapiens 4-aminobutyrate aminotransferase (ABAT), nuclear gene encoding mitochondrial protein, transcript variant 1, mRNA [NM_020686]" GO:0003867(4-aminobutyrate transaminase activity)|GO:0005739(mitochondrion)|GO:0005759(mitochondrial matrix)|GO:0007268(synaptic transmission)|GO:0009448(gamma-aminobutyric acid metabolism)|GO:0016740(transferase activity)|GO:0030170(pyridoxal phosphate binding)|GO:0042135(neurotransmitter catabolism)|GO:0047298((S)-3-amino-2-methylpropionate transaminase activity) ACGAGGCACCTTTTGCTCCTTCGATACTCCCGATGATTCCATACGGAATAAGCTCATTTT
14 A_23_P216649 NM_005502 FALSE NM_005502 NM_005502 19 ABCA1 "ATP-binding cassette, sub-family A (ABC1), member 1" Hs.429294 ENST00000374736 THC2268032 ref|NM_005502|gb|AF165281|ens|ENST00000374736|ens|ENST00000297693 chr9:104625987-104625928 hs|9q31.1 "Homo sapiens ATP-binding cassette, sub-family A (ABC1), member 1 (ABCA1), mRNA [NM_005502]" GO:0000166(nucleotide binding)|GO:0005515(protein binding)|GO:0005524(ATP binding)|GO:0005624(membrane fraction)|GO:0005887(integral to plasma membrane)|GO:0006629(lipid metabolism)|GO:0006810(transport)|GO:0008202(steroid metabolism)|GO:0008203(cholesterol metabolism)|GO:0008509(anion transporter activity)|GO:0015248(sterol transporter activity)|GO:0016020(membrane)|GO:0016887(ATPase activity) CAAAATTCCATTACAGGGGCAGTGCCTTTGTAGCCTATGTCTTGTATGGCTCTCAAGTGA
15 A_24_P235429 NM_005502 FALSE NM_005502 NM_005502 19 ABCA1 "ATP-binding cassette, sub-family A (ABC1), member 1" Hs.429294 ENST00000374736 THC2268032 ref|NM_005502|ens|ENST00000374736|ens|ENST00000297693|gb|AK027864 chr9:104623318-104623259 hs|9q31.1 "Homo sapiens ATP-binding cassette, sub-family A (ABC1), member 1 (ABCA1), mRNA [NM_005502]" GO:0000166(nucleotide binding)|GO:0005515(protein binding)|GO:0005524(ATP binding)|GO:0005624(membrane fraction)|GO:0005887(integral to plasma membrane)|GO:0006629(lipid metabolism)|GO:0006810(transport)|GO:0008202(steroid metabolism)|GO:0008203(cholesterol metabolism)|GO:0008509(anion transporter activity)|GO:0015248(sterol transporter activity)|GO:0016020(membrane)|GO:0016887(ATPase activity) CCAAAGAGCCATGTGTCATGTAATACTGAACCACTTTGATATTGAGACATTAATTTGTAC
16 A_24_P289265 AK024328 FALSE AK024328 19 ABCA1 "ATP-binding cassette, sub-family A (ABC1), member 1" Hs.429294 ENST00000341579 THC2262409 gb|AK024328|ens|ENST00000341579|ens|ENST00000374735|thc|THC2262409 chr9:104697803-104697744 hs|9q31.1 "Homo sapiens cDNA FLJ14266 fis, clone PLACE1002437, highly similar to ATP-BINDING CASSETTE TRANSPORTER 1. [AK024328]" GO:0000166(nucleotide binding)|GO:0005515(protein binding)|GO:0005524(ATP binding)|GO:0005624(membrane fraction)|GO:0005887(integral to plasma membrane)|GO:0006629(lipid metabolism)|GO:0006810(transport)|GO:0008202(steroid metabolism)|GO:0008203(cholesterol metabolism)|GO:0008509(anion transporter activity)|GO:0015248(sterol transporter activity)|GO:0016020(membrane)|GO:0016887(ATPase activity) GTGCTTCTGTACCAAAAGTGGAATTTCACGAGAGACATATTTTGAAACATTTCTCCTTTT
17 A_23_P43504 NM_001606 FALSE NM_001606 NM_001606 20 ABCA2 "ATP-binding cassette, sub-family A (ABC1), member 2" Hs.421202 ENST00000265662 THC2374850 ref|NM_001606|ref|NM_212533|gb|AF178941|ens|ENST00000265662 chr9:137178196-137178137 hs|9q34.3 "Homo sapiens ATP-binding cassette, sub-family A (ABC1), member 2 (ABCA2), transcript variant 1, mRNA [NM_001606]" "GO:0000166(nucleotide binding)|GO:0005524(ATP binding)|GO:0005765(lysosomal membrane)|GO:0006629(lipid metabolism)|GO:0006810(transport)|GO:0008203(cholesterol metabolism)|GO:0008372(cellular component unknown)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0016887(ATPase activity)|GO:0042626(ATPase activity, coupled to transmembrane movement of substances)|GO:0043190(ATP-binding cassette (ABC) transporter complex)" AGGACACGCTCCACTGACCACCCAGAGCTGGGCCAGGGACTCAACAATGGGGACAGAAGT
18 A_23_P140876 NM_001089 FALSE NM_001089 NM_001089 21 ABCA3 "ATP-binding cassette, sub-family A (ABC1), member 3" Hs.26630 ENST00000301732 THC2257987 ref|NM_001089|ens|ENST00000301732|ens|ENST00000358568|ens|ENST00000382381 chr16:2266323-2266264 hs|16p13.3 "Homo sapiens ATP-binding cassette, sub-family A (ABC1), member 3 (ABCA3), mRNA [NM_001089]" "GO:0000166(nucleotide binding)|GO:0005215(transporter activity)|GO:0005524(ATP binding)|GO:0005624(membrane fraction)|GO:0005886(plasma membrane)|GO:0006810(transport)|GO:0016021(integral to membrane)|GO:0016887(ATPase activity)|GO:0042493(response to drug)|GO:0042599(lamellar body)|GO:0042626(ATPase activity, coupled to transmembrane movement of substances)" CCCAGTGACTTGTCCAAGTTTACACACGACACTAATCTCCCCTGGGGAGGAAGCGGGAAG
19 A_23_P171258 NM_004299 FALSE NM_004299 NM_004299 22 ABCB7 "ATP-binding cassette, sub-family B (MDR/TAP), member 7" Hs.370480 ENST00000253577 NP1072532 ref|NM_004299|gb|AF133659|ens|ENST00000253577|ens|ENST00000373394 chrX:74056414-74056355 hs|Xq13.3 "Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 7 (ABCB7), nuclear gene encoding mitochondrial protein, mRNA [NM_004299]" "GO:0000166(nucleotide binding)|GO:0005524(ATP binding)|GO:0005739(mitochondrion)|GO:0005743(mitochondrial inner membrane)|GO:0006810(transport)|GO:0015232(heme transporter activity)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0016887(ATPase activity)|GO:0042626(ATPase activity, coupled to transmembrane movement of substances)" CATGGTTTGCTTGCTAACCCTCATAGTATCTATTCAGAAATGTGGCATACACAGAGCAGC
20 A_23_P251660 NM_001090 FALSE NM_001090 NM_001090 23 ABCF1 "ATP-binding cassette, sub-family F (GCN20), member 1" Hs.118354 ENST00000376539 THC2278043 ref|NM_001090|ref|NM_001025091|gb|AF027302|gb|BC034488 chr6:30666612-30666671 hs|6p21.33 "Homo sapiens ATP-binding cassette, sub-family F (GCN20), member 1 (ABCF1), transcript variant 2, mRNA [NM_001090]" "GO:0000166(nucleotide binding)|GO:0005524(ATP binding)|GO:0006412(protein biosynthesis)|GO:0006954(inflammatory response)|GO:0008135(translation factor activity, nucleic acid binding)|GO:0016887(ATPase activity)|GO:0042626(ATPase activity, coupled to transmembrane movement of substances)" CCCACTCTGATTGCATCCATTTCTCTGAAAGACTTGTTTGTTCTGCTTCTCTTCATATAA

Total number of rows: 45220

Table truncated, full table size 20118 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap