NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL9022 Query DataSets for GPL9022
Status Public on Sep 01, 2009
Title UON_Campylobacter oligo array v1
Technology type spotted oligonucleotide
Distribution non-commercial
Organisms Campylobacter jejuni subsp. jejuni NCTC 11168 = ATCC 700819; Campylobacter jejuni RM1221; Campylobacter coli RM2228
Manufacturer University of Nottingham
Manufacture protocol The slides prepared for microarray were γ APS coated, A+ bar-coded Schott nexterion slides. The slides were printed according to Campylobacter dense array gal by Microgrid II GOD robot using TAS software version V2.4.03. This had 2500 pins with a 26 x 26 pin grid configuration. The spacing between the spots was 0.165 mm and the slides were rehydrated by incubation at room temperature in a humidity chamber for 30 min followed by a 30 min incubation at 60 ºC to dry. The slides were blocked in a solution containing 100 mM ethanolamine, 1 M Tris (pH 9.0), and 0.1% SDS for 15 min at 50 ºC, then thoroughly rinsed with water and spun dry. The slides contain duplicate sets of oligonucleotides representing the genomes of C. jejuni NCTC11168, RM1221 and C. coli RM2228. The arrays are based on the genomes of C. jejuni 11168, C. jejuni RM1221, C. coli RM2228 along with any miscellaneous genes and plasmids from other strains available in the database. They are composed of synthetic oligonucleotide 70-mers: Tm 71 °C ± 5 °C, location from 3’ end of gene >70 bp, poly (N) tract <8 bp, stem length in potential hairpin <8 bp contiguous bases common to any non-self ORF <20 bp, cross-hyb identity to all other genes <70%.
 
 
Contributor(s) John A, Scott A, Timms A, El-Shibny A, Connerton P, Connerton I
Submission date Aug 12, 2009
Last update date Sep 01, 2009
Contact name Amy John
E-mail(s) asj918@gmail.com
Organization name University of Nottingham
Street address Loughborough
City Leicestershire
ZIP/Postal code LE12 5RD
Country United Kingdom
 
Samples (54) GSM441396, GSM441397, GSM441398, GSM441399, GSM441400, GSM441401 
Series (4)
GSE17701 Genome analysis of C. jejuni and C. coli isolated from different regions of the same pig
GSE17799 Transcriptomic analysis of C. jejuni HPC5 with C. jejuni HPC5 R14, R20, R14A, R14B, R20A, R20B and R20C.
GSE17801 Transcriptomic analysis of C. jejuni grown in anaerobic jar with air mix and in Modular Atmospheric Controlled System

Data table header descriptions
ID
Block A grid of feature indicator
Column to determine the position of the spot
Row to determine the position of the spot
Name
SEQUENCE
NCTC11168.sequence_name acession number of NCTC 11168 with base pair range of feature
NCTC11168.genome_id acession number of the selected gene in NCTC 11168 genome
NCTC11168.entrez_geneid Entrez gene id of NCTC 11168
NCTC11168.gene_symbol gene symbol of the selected gene in NCTC 11168
NCTC11168.locus_tag Systematic gene id for the selected gene in NCTC 11168
NCTC11168.gene_start_coordinate chromosomal start co-ordinate of the selected feature in NCTC 11168
NCTC11168.gene_end_coordinate chromosomal end co-ordinate of the selected feature in NCTC 11168
NCTC11168.gene_strand strand orientation
NCTC11168.entrez_pid Entrez protein id of the selected gene in NCTC 11168
NCTC11168.description gene function
NCTC11168.CGH_type CGH type
NCTC11168.CGH_xhyb CGH xhyb of selected oligo in NCTC 11168
RM1221.sequence_name acession number of RM1221 with base pair range of feature
RM1221.genome_id acession number of the selected gene in RM 1221 genome
RM1221.entrez_geneid Entrez gene id of RM 1221
RM1221.gene_symbol gene symbol of the selected gene in RM 1221
RM1221.locus_tag Systematic gene id for the selected gene in RM 1221
RM1221.gene_start_coordinate chromosomal start co-ordinate of the selected feature in RM 1221
RM1221.gene_end_coordinate chromosomal end co-ordinate of the selected feature in RM 1221
RM1221.gene_strand strand orientation
RM1221.entrez_pid Entrez protein id of the selected gene in RM 1221
RM1221.description gene function
RM1221.CGH_type CGH type
RM1221.CGH_xhyb CGH xhyb of selected oligo in NCTC 11168
RM2228_sequence_id acession number of RM 2228 genome
RM2228_genbank_contig_id
RM2228entrez_geneid acession number of the selected gene in RM 2228 genome
RM2228_gene_symbol
RM2228_locus_tag
RM2228_gene_start_coord
RM2228_gene_end_coord
RM2228_strand
entrez_pid Entrez protein id of the selected gene in RM 2228
description gene function
ORF_LIST Entrez Gene locus tags
SPOT_ID

Data table
ID Block Column Row Name SEQUENCE NCTC11168.sequence_name NCTC11168.genome_id NCTC11168.entrez_geneid NCTC11168.gene_symbol NCTC11168.locus_tag NCTC11168.gene_start_coordinate NCTC11168.gene_end_coordinate NCTC11168.gene_strand NCTC11168.entrez_pid NCTC11168.description NCTC11168.CGH_type NCTC11168.CGH_xhyb RM1221.sequence_name RM1221.genome_id RM1221.entrez_geneid RM1221.gene_symbol RM1221.locus_tag RM1221.gene_start_coordinate RM1221.gene_end_coordinate RM1221.gene_strand RM1221.entrez_pid RM1221.description RM1221.CGH_type RM1221.CGH_xhyb RM2228_sequence_id RM2228_genbank_contig_id RM2228entrez_geneid RM2228_gene_symbol RM2228_locus_tag RM2228_gene_start_coord RM2228_gene_end_coord RM2228_strand entrez_pid description ORF_LIST SPOT_ID
opCcV0100001758 1 1 3 unknown ATACTTTTACAACAAAGTCAAACAAAGCAGAATTAAGAGTAGATATTTGTTCAAATTGCCATCCTTTTTT ref|NC_002163.1|:c158339-158139 NC_002163.1 904488 rpmE Cj0155c 158139 158339 15791543 50S ribosomal protein L31 Predict_CGH_oligo 25 ref|NZ_AAFL01000005.1|:c41386-41186 NZ_AAFL01000005.1 rpmE CCO1722 41186 41386 57168672 ribosomal protein L31 Cj0155c
CJ_Control_11 1 2 3 unknown ACCCAAAGAATTTTTTGTAGGGCACTGCACGTAGATTAAACAGTTATACCCTACGGCCAGCCTAGGACGG randomly-generated negative control CONTROL
opCcV0100001111.A 1 3 3 unknown --UNKNOWN
opCcV0100001292.90 1 4 3 unknown --UNKNOWN
opCcV0100001743 1 5 3 unknown AGAGGAAATTGGAAAGGAACTTAATGTCACTCGAGAAAGAGTGAGACAAATAGAAAGCTCAGCTATAAAA ref|NC_002163.1|:931191-933059 NC_002163.1 905292 rpoD Cj1001 931191 933059 + 15792328 RNA polymerase sigma factor (sigma-70) Predict_CGH_oligo 20 ref|NC_003912.7|:1008679-1010547 NC_003912.7 3231590 rpoD CJE1081 1008679 1010547 + 57237826 RNA polymerase sigma factor Predict_CGH_oligo 29 ref|NZ_AAFL01000007.1|:c68345-66480 NZ_AAFL01000007.1 rpoD CCO1063 66480 68345 57168867 RNA polymerase sigma factor RpoD Cj1001, CJE1081
opCcV0100000243.50 1 6 3 unknown --UNKNOWN
opCcV0100001200.50 1 7 3 unknown --UNKNOWN
opCcV0100001415 1 8 3 unknown CAAATGTAAATGTTGAGATTAAAGATAATAATATTCTTTTTTCTCCAAAAGGTGAAGACAGACAAAGTAG ref|NC_002163.1|:c1613975-1613439 NC_002163.1 905966 rplF Cj1692c 1613439 1613975 15792995 50S ribosomal protein L6 Predict_CGH_oligo 28 ref|NZ_AAFL01000012.1|:5650-6186 NZ_AAFL01000012.1 CCO1813 5650 6186 + 57504683 50S ribosomal protein L6 Cj1692c Cj1692c
opCcV0100001782 1 9 3 unknown AGGTCTTGCTTATAAAGAACTTTTAAGTGAATTCCAAAAAGATGATGAAACTAAAGCTATTGTAATGATA ref|NC_002163.1|:498354-499223 NC_002163.1 904862 sucD Cj0534 498354 499223 + 15791895 succinyl-coA synthetase alpha chain Predict_CGH_oligo 29 ref|NZ_AAFL01000001.1|:c354770-353901 NZ_AAFL01000001.1 sucD CCO0631 353901 354770 57167579 SucD Cj0534
opCcV0100000243.80 1 10 3 unknown --UNKNOWN
opCcV0100001200.80 1 11 3 unknown --UNKNOWN
opCcV0100001415.70 1 12 3 unknown --UNKNOWN
opCcV0100001667 1 1 4 unknown TAAAAGGTAAAGATGCTCATTTTGATAAACTATTTGATCGTCATAATGAACTTGATGACATGATTAAAGA ref|NC_002163.1|:c416466-416251 NC_002163.1 904772 Cj0449c 416251 416466 15791813 hypothetical protein Predict_CGH_oligo 22 ref|NZ_AAFL01000004.1|:16300-16515 NZ_AAFL01000004.1 CCO0540 16300 16515 + 57168585 Protein of unknown function (DUF465) family Cj0449c
opCcV0100001690 1 2 4 unknown ref|NZ_AAFL01000021.1|:10072-10293 NZ_AAFL01000021.1 CCOA0083 10072 10293 + 57505072 hypothetical protein CCOA0083
opCcV0100001622 1 3 4 unknown ref|NZ_AAFL01000006.1|:c63644-63540 NZ_AAFL01000006.1 CCO0136 63540 63644 57168762 hypothetical protein CCO0136
opCcV0100001646 1 4 4 unknown AAGCTTTTTTTCAAGGAGAATTTAGAATAGAAAAGCCTTATTTGTTAAGTATTTTTTTAGAAGATAGGCA ref|NC_002163.1|:602326-603186 NC_002163.1 905135 Cj0641 602326 603186 + 15792001 hypothetical protein Predict_CGH_oligo 29 ref|NC_003912.7|:679334-680194 NC_003912.7 3230697 CJE0744 679334 680194 + 57236954 ATP-NAD kinase, putative Predict_CGH_oligo 32 ref|NZ_AAFL01000001.1|:c264071-263211 NZ_AAFL01000001.1 CCO0721 263211 264071 57167667 inorganic polyphosphate/ATP-NAD kinase Cj0641, CJE0744
opCcV0100001670 1 5 4 unknown AACTGCAACAATGATACAATATTGTGCACCTTTGATTATAATGCTTTATTTGTGCTTTAAAAATAAAAAA ref|NC_002163.1|:806075-806947 NC_002163.1 905161 Cj0860 806075 806947 + 15792198 probable integral membrane protein Predict_CGH_oligo 28 ref|NC_003912.7|:883885-884757 NC_003912.7 3231460 CJE0947 883885 884757 + 57237701 integral membrane protein Predict_CGH_oligo 29 ref|NZ_AAFL01000001.1|:19093-19953 NZ_AAFL01000001.1 CCO0985 19093 19953 + 57167917 membrane protein Cj0860, CJE0947
opCcV0100001693 1 6 4 unknown ref|NC_003912.7|:1054669-1055937 NC_003912.7 3231647 CJE1138 1054669 1055937 + 57237882 hypothetical protein Predict_CGH_oligo 22 ref|NZ_AAFL01000016.1|:8300-9568 NZ_AAFL01000016.1 CCOA0042 8300 9568 + 57504936 hypothetical protein CJE1138
opCcV0100001993 1 7 4 unknown TGAATTTATGAGTAAAGAAGAGCTTAAAAAATTTCTTGATGCTATTGAAAATGCAGATTTTAAAAACAAT ref|NC_002163.1|:c810335-809271 NC_002163.1 905165 xerD Cj0863c 809271 810335 15792201 DNA recombinase Predict_CGH_oligo 29 ref|NC_003912.7|:c888145-887081 NC_003912.7 3231463 CJE0950 887081 888145 57237704 site-specific recombinase, phage integrase Predict_CGH_oligo 25 ref|NZ_AAFL01000001.1|:c23357-22293 NZ_AAFL01000001.1 CCO0982 22293 23357 57167914 DNA recombinase Cj0863c Cj0863c, CJE0950
opCcV0100002017 1 8 4 unknown ref|NZ_AAFL01000034.1|:c638-420 NZ_AAFL01000034.1 CCOA0168 420 638 57505185 conserved hypothetical protein CCOA0168

Total number of rows: 5190

Table truncated, full table size 1935 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap