|
Status |
Public on Oct 06, 2016 |
Title |
4C WT BorSox9tel |
Sample type |
SRA |
|
|
Source name |
E12.5 limb buds
|
Organism |
Mus musculus |
Characteristics |
genotype: WT age: E12.5 viewpoint: Bor (Sox9 tel)
|
Extracted molecule |
genomic DNA |
Extraction protocol |
4C-seq libraries were generated from microdissected tissues or cells as described previously (van de Werken et al., 2012). DpnII was used as primary, BfaI as secondary restriction enzymes (Csp6I and NlaIII for human samples). For each viewpoint, a total of 1.6 mg of each library was amplified in 8 or 16 PCR reactions, depending on PCR efficiencies. Samples were multiplexed and sequenced with Ilumina Hi-Seq technology. The following primers were used: Sox9-TSS_1 CCACGAAAGTGTGTTTATATTCT Sox9-TSS_2 TGGCTATTGTTTGTAAATCTCTT Kcnj2-TSS_1 CGGTGGTGGAGAGAAAGA Kcnj2-TSS_2 TCACCAAACAACCTCTACAAA LacZ_1 TCCGACTTCAACTGTAGGG LacZ_2 GCAGAGCCATCTATTGCTTA BOR-Sox9tel_1 TTTGACTCCAAGGACCAGA BOR-Sox9tel_2 TGTGTAAAGGCGGACAGA Sox9-TAD_1 AACTGGGTATAGTGTGGAGAGA Sox9-TAD_2 GGACATCAATGGAACATAGC BOR-Kcnj/Sox9_1 AATGCTGTGGACATCCTG BOR-Kcnj/Sox9_2 TCCGTCAAGTTCCATGTG Kcnj-TAD_1 TCTGTGCCAAATGAACTATTCT Kcnj-TAD_2 AGCACCATCTGTCCTCCTAT BOR-Kcnjcen_1 AAGAAGAGGGGCTCAAAAT BOR-Kcnjcen_2 CTGATTGGCATGGGATAGT SOX9-TSS_1 TCCAAGTGTGTAAGTTTGTCG SOX9-TSS_2 AATCTCCTGGACCCCTTC KCNJ2-TSS_1 TTCAGTGAACGTATTTGTTGAA KCNJ2-TSS_2 GAGCGTTTGATGTTTTACCA Samples were multiplexed and sequenced with Ilumina Hi-Seq technology using 100bp paired-end or single end reads according to the manufacturer´s protocol.
|
|
|
Library strategy |
OTHER |
Library source |
genomic |
Library selection |
other |
Instrument model |
Illumina HiSeq 1500 |
|
|
Data processing |
4C-seq reads were cleaned of the primer sequence and mapped to a corresponding reference (GRCh37/hg19 or NCBI37/mm9) using BWA-MEM (v0.7.12-r1044) with default settings. 4C-seq contacts were analyzed in the murine region chr11:108500000-115000000 and the human region chr17:67000000-75000000. To calculate read count profiles the viewpoint and adjacent fragments 1.5 kb up- and downstream were removed. A sliding window of 10 fragments was chosen to smooth the data and data was normalized to reads per million mapped reads (RPM). To compare interaction profiles of different samples, we obtained the log2 fold change for each window of normalized reads. Genome_build: mm9, hg19
Supplementary_files_format_and_content: bedgraph files of the coverage and the calculated ratios
|
|
|
Submission date |
Feb 18, 2016 |
Last update date |
May 15, 2019 |
Contact name |
Daniel Murad Ibrahim |
E-mail(s) |
ibrahim@molgen.mpg.de, daniel.ibrahim@bih-charite.de
|
Phone |
030 84131516
|
Organization name |
Berlin Institute of Health
|
Department |
Center for Regenerative Therapies
|
Street address |
Augustenburger Platz 1
|
City |
Berlin |
State/province |
Berlin |
ZIP/Postal code |
13353 |
Country |
Germany |
|
|
Platform ID |
GPL18480 |
Series (2) |
GSE78067 |
Pathogenicity of genomic duplications is determined by formation of novel chromatin domains (neo-TADs) (4C-seq) |
GSE78109 |
Pathogenicity of genomic duplications is determined by formation of novel chromatin domains (neo-TADs) |
|
Relations |
SRA |
SRX1592516 |
BioSample |
SAMN04503055 |