 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Oct 01, 2019 |
| Title |
rrp6∆_rep2 |
| Sample type |
SRA |
| |
|
| Source name |
yeast cells
|
| Organism |
Saccharomyces cerevisiae |
| Characteristics |
genotype: rrp6[delta]::KanMX
parental strain: BY4741(MATa his3[delta]1 leu2[delta]0 met15[delta]0 ura3[delta]0)
|
| Treatment protocol |
For polyribosome analysis 100 mL of S. cerevisiae cells at OD600 ~1 were treated with cycloheximide for 5 minutes (100 µg/mL, final concentration), harvested by centrifugation and transferred to ice. Pellets were washed with ice-cold lysis buffer and resuspended in 700µL lysis buffer. Lysis buffer contains 20 mM Tris-HCl, pH 8, 140 mM KCl, 5 mM MgCl2 , 0.5 mM DTT, 1% Triton X-100, 100 µg/mL cycloheximide, 500 µg/mL heparin and complete EDTA-free protease inhibitor (1 tablet per 10 mL, Sigma Aldrich). For 5PSeq cells were shifted for 5 minutes to YP media without glucose (1% yeast extract, 2% peptone) prior to harvesting.
|
| Growth protocol |
Saccharomyces cerevisiae grown in YPD at 30°C.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
For polyribosome analysis, cells resuspended on Lysis buffer were transferred to pre-cooled 1.5mL screw-tubes with 300 µL glass beads and supplemented with 100 units of RNAse inhibitor (RNAsin plus, Promega). Cells were lysed using a FastPrep-24 shaker (6.0m/s for 15 seconds, MP biomedicals). Supernatant was recovered after 5 minutes centrifugation at 2300g, and cleared with an additional centrifugation at 5900g. Extracts were supplemented with glycerol (5% final v/v) and stored at -70C. 10-50% sucrose gradients were prepared with a Gradient Master BIOCOMP (Nycomed Pharma). Sucrose solution contains 20 mM Tris-HCl, pH 8, 140 mM KCl, 5 mM MgCl2 , 0.5 mM DTT, 100 µg/mL cycloheximide and sucrose (from 10 to 50 %). Cleared cell extracts were ultracentifuged at 34400 rpm for 2 hours 40 minutes at 4C using a C-1000 XP centrifuge with SW40 rotor (Beckman Coulter). Gradient UV absorption at 254 nm was measured and selected fractions were selected for 5’cap library preparation (5µg purified RNA per sample). Polyribosome fraction (i.e., 2n+) was compared with the total extract prior to fractionation). For 5PSeq RNA was extracted from yeast cells using the hot phenol procedure. The amount of RNA was quantified in a Nanodrop 2000 Spectrophotometer (Thermo Scientific) and RNA integrity was checked by agarose gel electrophoresis.
5’cap polyribosome fractioned libraries was performed as previously described (Pelechano et al. Nat Protocols. 2016 PMID: 26820793). In brief, 10µg total RNA was treated with Calf intestinal alkaline phosphatase (NEB)
to remove 5′P from fragmented and non-capped molecules. After purification, mRNA caps were removed using 3.75 units of Cap-Clip (Biozyme) exposing a 5’P in those molecules previously capped. Samples were ligated overnight at 16ºC with a DNA/RNA oligo (rP5_RND: TTTCCCTACACGACGCTCTTCCGATrCrUrNrNrNrNrNrNrNrN ) using T4 RNA ligase 1 (New England Biolabs). RNA integrity after ligation was assayed by agarose gel electrophoresis and polyA RNA was purified using oligo dT magnetic beads. After this, ligated mRNA was fragmented at 80ºC for 5 min in the presence of RNA fragmentation buffer (40 mM Tris-acetate, pH 8.1, 100 mM KOAc, 30 mM MgOAc). Ligated RNA was subjected to reverse transcription using random hexamers with Superscript II (Life Technologies) with the following program: 10 min at 25ºC, 50 min at 42ºC and heat inactivated for 15 min at 72ºC. Second strand cDNA synthesis was performed by a single PCR cycle (1 min at 98ºC; 2 min at 50ºC and 15 min at 72ºC) using Phusion High-Fidelity PCR Master Mix (New England Biolabs). A biotinilated oligo (BioNotI-P5-PET: [Btn]TATAGCGGCCGCAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT) was added during the generation of the second cDNA strand. Double stranded cDNA was purified using Ampure XP (Beckman Coulter) or HighPrep (Magbio) beads. After the samples were bound to streptavidin coated magnetic beads (M-280 Dynabeads, Life Technologies) and subjected to standard Illumina end-repair, dA addition and adapter ligation was performed as previously described. Libraries were enriched by PCR and sequenced in an Illumina HiSeq 2000 instrument. 5PSeq methods was performed as previously described (PMID: 26820793). 6µg of total RNA was used as input. In brief a RNA oligo (rP5_RND) containing an Illumina adaptor and unique molecular identifiers (UMI) was ligated to the intermediates of mRNA co-translation degradation (5’P). Ribosomal RNA was depleted using Ribo-Zero Magnetic Gold Kit (Illumina).Libraries were PCR amplified (14 cycles). Ampure beads size selected libraries with an average length of 451 nt were sent for sequencing (llumina NextSeq 500 instrument).
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
Library strategy: 5'cap-seq
For polyribosomes 5’ cap sequencing reads, random barcodes were first extracted and added to the reads name. The reads were aligned to yeast genome with Novoalign (http://www.novocraft.com) using default setting.
For 5’PSeq each read we trimmed the first 8 nt (UMI, unique molecular identifier) and align the rest to S. cerevisiae genome (version R64-1-1) using STAR 2.5.3a default settings except AlignIntronMax(2500). Reads with the same 5’mapping site and UMI were considered PCR duplicates and omitted from the analysis.
Genome_build: S. cerevisiae R64-1-1
Supplementary_files_format_and_content: Bedgraph files for UMI collapsed reads for positive and negative strand for 5PSeq. For polyribosome 5'cap sequencing both strands are in the same file.
|
| |
|
| Submission date |
Aug 28, 2018 |
| Last update date |
Oct 02, 2019 |
| Contact name |
Vicent Pelechano |
| E-mail(s) |
vicente.pelechano.garcia@ki.se
|
| Organization name |
ScilifeLab - Karolinska Institutet
|
| Department |
MTC
|
| Street address |
Nobels väg 16
|
| City |
Solna |
| ZIP/Postal code |
SE-17177 |
| Country |
Sweden |
| |
|
| Platform ID |
GPL19756 |
| Series (1) |
| GSE119134 |
Detection of cryptic unstable transcripts associated with ribosomes in yeast |
|
| Relations |
| BioSample |
SAMN09927985 |
| SRA |
SRX4618281 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM3359406_R6-2_neg.BedGraph.gz |
9.0 Mb |
(ftp)(http) |
BEDGRAPH |
| GSM3359406_R6-2_pos.BedGraph.gz |
9.2 Mb |
(ftp)(http) |
BEDGRAPH |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
