GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM4520635

Query DataSets for GSM4520635

Status

Public on Dec 07, 2020

Title

HH8 NP rep1

Sample type

SRA

Source name

Chicken neural plate

Organism

Gallus gallus

Characteristics

Stage: HH8
enhancer utilized for cell sorting: Sox2 N2:eGFP and NNE/NC:mCherry (Uchikawa et al., 2003)
tissue: neural plate

Extracted molecule

total RNA

Extraction protocol

HH4 embryos were transfected with neural plate or neural crest specific enhancers (listed above) and developed to HH8. Embryo heads were dissected and dissociated in Accumax (Accutase, SCR006) cell dissociation solution for 20 minutes at RT under mild agitation. Dissociated cells were FACs sorted (GFP+) directly into 1ml of Trizol (Thermo Fisher Scientific, 15596026) for total RNA isolation (10,000 cells/experiment). RNA was isolated according to manufacturer's protocol.
Small RNA-sequencing libraries were generated using NEB Next Small RNA Library Prep Set for Illumina (NEB, E7330S), according to manufacturer’s instructions (total RNA input of 100ng/ul for each library). Libraries were size selected on a Pippin Prep instrument for fragments between 105bp and 155bp according to manufacturer’s suggestions. The tru-seq barcoded libraries were sequenced on an Illumina NextSeq 500 instrument with paired-end 37 bp reads.

Library strategy

miRNA-Seq

Library source

transcriptomic

Library selection

size fractionation

Instrument model

Illumina NextSeq 500

Data processing

Base calling was performed using CASAVA 1.8
Small RNA-sequencing reads were processed and quantified using the miRDeep2 modules mapper and quantifier (Friedlander et al., 2012). Briefly, reads were trimmed to remove the 3’ adaptor sequences and were aligned to the chicken reference genome Galgal5 using bowtie with no mismatches allowed. Reads consisting of 18–35 nucleotides were kept for further analysis. Next, mature and star miRNA sequences are mapped against annotated chicken precursor miRNAs obtained from miRbase (Kozomara et al., 2014). Mapped small RNA-sequencing reads were then intersected with the mature miRNA mappings to obtain a read count table. miRDeep 2 parameters: mapper (-h -e -k AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -1 18 -m -i -p) quantifier (-p precursors_miRBase_galGal5.fa -m miRBase_galGal5.fa -r -t Chicken -d -e 0 -W -g 0)
Differential gene expression analysis for mature miRNA reads between neural plate and neural crest cells was performed using DESeq2 (Love, et al., 2014)
Genome_build: galGal5
Supplementary_files_format_and_content: (1) .csv file containing processed read counts for all samples from miRDeep2 (2) .csv file containing DESeq2 differential gene expression analysis results between neural plate and neural crest samples

Submission date

May 06, 2020

Last update date

Dec 07, 2020

Contact name

Marcos Simoes-Costa

E-mail(s)

simoescosta@cornell.edu

Organization name

Cornell University

Department

Molecular Biology and Genetics