 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on May 26, 2021 |
| Title |
PH0-S-1 (Peg_SHAMf1_res) |
| Sample type |
SRA |
| |
|
| Source name |
Arabidopsis thaliana seedling shoots exposed to water for 1h
|
| Organism |
Arabidopsis thaliana |
| Characteristics |
tissue: Shoot
genotype: WT
treatment: water for 1h
|
| Treatment protocol |
For osmotic stress treatment, PEG average molecular weight 8,000 powder (Sigma-Aldrich) was used. For PEG solutions, 30% (w/v), PEG was dissolved in double-distilled (dd)H2O and pH was adjusted to 5.8 using HCl and KOH osmotic pressure measured at -2.0 MPa. Solutions were supplemented with His (5 mm) or SHAM (0.1 mm) where indicated in Seedlings were exposed to 30% PEG + 1mM SHAM for 0, 1, 2, 3 h in aqueous solution.
|
| Growth protocol |
Arabidopsis (Arabidopsis thaliana; ecotype Columbia-0) seedlings (7 d old) were grown under white light in a 16-h-light/8-h-dark cycle at 21°C on Murashige and Skoog medium, supplemented with 1% (w/v) Suc and 0.8% (w/v) Phytoagar (Invitrogen).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Three replicates of Arabidopsis seedlings (30 to 50 7-d-old seedlings per biological replicate) were used for each treatment. After treatment, the roots and shoots were separated, and RNA was extracted separately from frozen tissues using a standard Trizol extraction method (Sigma-Aldrich).
Libraries were prepared with the MARS-seq protocol (Diego Adhemar Jaitin, 2017) and sequenced using Illumina NextSeq 500 High Output v2 Kit (75 cycles).
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
MARS-seq
8B
|
| Data processing |
Bcl files were converted into fastq by bcl2fastq. Demultiplexing is done using the sample barcode found on R2, the UMI found on R2 is inserted in the read name (in R1 fastq). R1 Fastq data submitted.
MARS-seq analysis was done using the UTAP transcriptome analysis pipeline (Kohen et al., 2019). Reads were trimmed using cutadapt, (parameters: -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -a “A{10}” –times 2 -u 3 -u -3 -q 20 -m 25).
Reads were mapped to genome Tair-11 using STAR, v2.4.2a (parameters: –alignEndsType EndToEnd, –outFilterMismatchNoverLmax 0.05, –twopassMode Basic, –alignSoftClipAtReferenceEnds No).
The pipeline quantifies the 3’ of Araport annotated genes (The 3’ region contains 1,000 bases upstream of the 3’ end and 100 bases downstream):
We used the 3 end (1000bp) of the transcripts for counting the number of reads per gene. Counting (UMI counts) was done after marking duplicates (in-house script) using HTSeq-count (DOI: 10.1093/bioinformatics/btu638) in union mode.
Genome_build: Further analysis is done for genes having minimum 5 read in at least one sample.
Supplementary_files_format_and_content: Normalization of the counts and differential expression analysis was performed using DESeq2 , with the parameters: betaPrior=True, cooksCutoff=FALSE, independentFiltering=FALSE. Raw P values were adjusted for multiple testing using the procedure of Benjamini and Hochberg.
|
| |
|
| Submission date |
Jun 15, 2020 |
| Last update date |
May 26, 2021 |
| Contact name |
Tomer Chen |
| E-mail(s) |
tomerlivechen@gmail.com
|
| Organization name |
Weizmann Institute of Science
|
| Department |
Plant and Environmental Sciences
|
| Street address |
P.O.box 26
|
| City |
Rehovot |
| ZIP/Postal code |
7610001 |
| Country |
Israel |
| |
|
| Platform ID |
GPL19580 |
| Series (2) |
| GSE152456 |
Transcriptome analysis of Arabidopsis thaliana shoots and roots, exposed to PEG-induced osmotic shock, PEG+Histidine, PEG+SHAM [20190311_172119_Peg_SHAMf1_res] |
| GSE152462 |
A role for lipoxygenase in the production of 1O2 and promoting the root's response to osmotic stress in Arabidopsi |
|
| Relations |
| BioSample |
SAMN15237657 |
| SRA |
SRX8547574 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
