|
Status |
Public on Jan 24, 2023 |
Title |
RNAseq.Red.Jungle.Fowl.Davis.testis.wt.adult.rep2 |
Sample type |
SRA |
|
|
Source name |
testis
|
Organism |
Gallus gallus |
Characteristics |
tissue: whole testis breed: Red Jungle Fowl age: adult genotype: wildtype fraction: rRNA depleted RNA
|
Treatment protocol |
Rooster testes from a 15 months-old White Leghorn of the Cornell Special C strain were used for high-throughput sequencing.
|
Growth protocol |
Animals mice were maintained and used according to guidelines for animal care of the NIH and the University Committee on Animal Resources at the University of Rochester. Chickens were used according to guidelines for animal care of the NIH and the University Committee on Animal Resources at the University of Rochester.
|
Extracted molecule |
total RNA |
Extraction protocol |
Total RNAs were extracted using mirVana miRNA Isolation Kit (ThermoFisher, AM1560). 1, Strand-specific RNA-seq: libraries were constructed following the TruSeq RNA sample preparation protocol. rRNAs were depleted from total RNAs by Ribo-Zero Gold (Epicentre Biotechnologies, Madison, WI, USA). 2, Small RNA-seq: Testes samples were lysed and treated with sodium periodate for library constrution. The 3'-adapter is TGGAATTCTCGGGTGCCAAGG and has been trimmed in the raw data.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina HiSeq 2000 |
|
|
Description |
RNA-seq
|
Data processing |
Analyses were performed using piPipes v1.4. All data from the small RNA-seq, RNA sequencing, were analyzed using the latest mouse genome release galGal6 (GCA_000002315.5). Generally, one mismatch is allowed for genome mapping. For RNA-seq reads, the expression per transcript was normalized to the top quartile of expressed transcripts per library calculated by Cuffdiff, and the tpm (transcripts per million) value was quantified using the Salmon software. For small RNA-seq analysis, uniquely mapping reads excluding rRNA and miRNA between 26 nt and 32 nt were selected for further analysis. Genome_build: Gallus gallus: galGal6 (GCA_000002315.5) Supplementary_files_format_and_content: For small RNA-seq, processed data files are unique genome alignment results in BED2 format (https://github.com/bowhan/piPipes/wiki/nomenclature). RNAseq quantification results are .sf files output by Salmon software.
|
|
|
Submission date |
Jan 22, 2021 |
Last update date |
Feb 08, 2023 |
Contact name |
Jiafei Shen |
E-mail(s) |
shenjiafei0118@yahoo.com
|
Phone |
13201907629
|
Organization name |
International Institutes of Medicine, The Fourth Affiliated Hospital, Zhejiang University School of Medicine
|
Street address |
N1 Shangcheng Road
|
City |
Yiwu |
ZIP/Postal code |
322000 |
Country |
China |
|
|
Platform ID |
GPL16133 |
Series (1) |
GSE165330 |
Amniotes co-opt intrinsic genetic instability to protect germ-line genome integrity |
|
Relations |
BioSample |
SAMN17496640 |
SRA |
SRX9920303 |