 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Feb 15, 2023 |
| Title |
WGBS, ago4-4/AGO4, biol rep 2 |
| Sample type |
SRA |
| |
|
| Source name |
Inflorescence
|
| Organism |
Arabidopsis thaliana |
| Characteristics |
tissue: Inflorescence
genotype: ago4-4/AGO4
|
| Growth protocol |
All Arabidopsis thaliana plants were grown at 21 C with 16 h light and 8 h dark in a growth room
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
For each library, genomic DNA was extracted from the inflorescence tissues of a single plant using Nucleon Phytopure DNA Extraction Kit (Cytiva).
Whole-genome bisulfite sequencing libraries were prepared using Perkin Elmer’s Nextflex Bisulfite-Seq Kit per the manufacturer’s instruction. Approximately 500 ng DNA fragments were end-repaired, 3’ adenylated, and ligated with adapters. Unmethylated cytosines in the adapter-ligated DNA were chemically converted by EZ DNA Methylation-Gold Kit (Zymo Research Corp.) following the manufacturer’s instruction. The CT converted products were purified and subjected to 12 cycles of PCR amplification before single-ended Illumina sequencing.
|
| |
|
| Library strategy |
Bisulfite-Seq |
| Library source |
genomic |
| Library selection |
RANDOM |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
To analyze the whole-genome bisulfite sequencing data, 3’ adapters were removed by Cutadapt v1.18 with the following options: -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -m 15 -q 20.
Trimmed reads were aligned to the Arabidopsis TAIR10 genome by bsmap2 with the following options: -w 100 -n 1 -p 3 -v 0.08. Methylation ratios at individual cytosine sites were calculated using methratio.py.
Arabidopsis genome was binned into 100 nt windows with CG, CHG, and CHH (where H represents any nucleotide except G) methylation calculated individually. To avoid regions with low sequencing coverage, only bins with at least 4 cytosines that were each covered by no less than 4 reads were included in this analysis.
Bins that have at least 10% less CHH methylation in the two independent replicates of ago4-4 compared to the two independent replicates of wild-type Ws ecotype plants were defined as differentially methylated bins.
Differentially methylated bins within 200 bp from each other were merged into differentially methylated regions (DMRs). Cytosine methylation levels at methylated regions were caculated.
Assembly: TAIR10
Supplementary files format and content: Tab-delimited text files include chromosome, coordinates of cytosines, strandedness, sequence context, methylation ratio, effective total C counts, total C counts, total G counts on the reverse strand, total G+A counts on the reverse strand, lower bound of 95% confidence interval of methylation ratio, and upper bound of 95% confidence interval of methylation ratio
|
| |
|
| Submission date |
Apr 21, 2022 |
| Last update date |
Feb 18, 2023 |
| Contact name |
Craig S. Pikaard |
| E-mail(s) |
cpikaard@indiana.edu
|
| Organization name |
Howard Hughes Medical Institute, Indiana University
|
| Department |
Department of Biology and Department of Molecular and Cellular Biochemistry
|
| Street address |
915 E. Third Street
|
| City |
Bloomington |
| State/province |
Indiana |
| ZIP/Postal code |
47405 |
| Country |
USA |
| |
|
| Platform ID |
GPL19580 |
| Series (2) |
| GSE201234 |
AGO4 slicer activity reveals the passenger strand function of plant 23 nt siRNAs and the post-slicing retention of target RNAs mediating RNA-directed DNA methylation [WGBS] |
| GSE201235 |
Enzymatic reactions of AGO4 in RNA-directed DNA methylation: siRNA duplex loading, passenger strand elimination, target RNA slicing, and sliced target retention |
|
| Relations |
| BioSample |
SAMN27723912 |
| SRA |
SRX14954000 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM6053239_GSF2981-ago4-AGO4-Rep2-WGBS_S6_methratio.txt.gz |
271.9 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
